Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23985  (registered. 2007)
Contig Information
Length 845 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 4
Wh_SHC Shoot grown with cold treatment 6
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit histone H1 [Zea mays]
Score 283
Evalue 1.676e-23
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23985
CTCTTTTCTGAAGCCGCAAGCGAGCAGAGCACACCGCACACGTAGCAGTTTCCCTTTCAGATATTTTCTTCGACTAGCCACCATGACTGCTTTGGCCAAG
CCCTCCGCCTCAGCGCCGAAGCCGAAGAAGACCTCCGCCGCTGGAGCCGCCCACCCGACCTACTTCGAGATGATCAAGGAGGCGATCGCGGCTCTCAAGG
ACAGGACCGGGTCGAGCTCGGTCGCCATCGCCAAGTTCATCGAGGAGAAGCACGGCAAGGCCCTCCCGGCCAACTTCAAGAAGATGCTCTCCGTCCAGCT
CCGCTCCTCCGCCGCCAAGGGCAAGCTCGTCAAGGTCAAGGCCTCCTACAAGCTCTCCGACGCCGCCAAGAAGGACTCCCCCAAGCCCAAGGCCAAGCCC
GCCGCCCCCAAGGCTGCGGCGAAGCCCGCAAAGGACGCCGCCAAGCCCAAGAAGAAGGCCTCCGCGAAGCCCAAGAAGGCCGCCGCCGCTGGCACGAAGC
GCAAGGCACCCGAGAAGAAGAAGCTGGTCGCCAAAGCCAAGAAGTCGCCCGCGGCGAAGGCCAAGGCGAAGCCGAAGACCGTCCGCTCCCCGGCCGCCAA
GAAGGCCCGCAAGGTCGCCTCCGCTTGATCTGATCTGATCTGATCTTATAGGTGGTTTTAGGTGTGCGTTGGTGCTCTGGGTCTGTACAAAAGGATGCCT
CATCCTCCCTGATTTAGGCTTCGGTTCTGCTAGGCAGGTTCTATGTACTATCGCTGGTGGTGTTTAGTGTCTGGAATGTTCAGGTGTCAGATGTATCCAG
CTCAAACTCTGAAATGAATTTGCAGTTTCCCAATTAAAAAAAAAA
page-top