Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23976  (registered. 2007)
Contig Information
Length 2257 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_022322 [Oryza sativa (japonica cultivar-group)]
Score 850
Evalue 6.61159e-148
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23976
GGGTTTCTCCCAGGGTTTTTCCCCGCGCCGCCGCCACCCCGCTCCTCCGGATCGCCGCCATGGCAGCCGCCGCCGCCGCCGCCGACCAGGCTACGAATTT
GCTGCAGAAGCTATCCCTTGATGCCAAGGCTGAAGCCATCGACGCGCCGGCGGCGAAGGAGAAGGCGTCCGGAGGGCTGGGCGGCAAGCTGAATGGTGTG
GCGGCGACTGGGAAGCCACGGGCGGCTGAGCAGTGGGCAAATCCTCAGGATTACAGCGATGCAAGCATGTATTATGGCGCCTACCCTGCTGCTTACTATT
GCGCAGGTTGGGGTGATTATTCCATGTACTTGAATCAGGATGGAGTGGAAACACCTACCGCTGGTGCCTATGGTGACATGTACTGCTATCCTCAATATGG
GCATGATGGTCAGATGTATGGGTCACAGCAATATCAGTACCCATCATCATACCACCAGCCCCAGAATACTGCCAGTAAGCCACAATACAAGTCTAAAACT
GACAAGCTAGCCCCGTCAAAGGATATTTCCTCCACTGTTGCTGATCCGCTGCATGCCGTAGCCAGTGCTCCCAAAGCCACTGCAAACAGCGTTGATGAGG
TAAAAGGTCTGAAGAAGACATCCACACCACTGAACCCAAGTGGGAACAATGGTAGTTACCTGAACCAAAGTAGCAGACCAGCTTATCCATGGTACGGTGG
CCAAATCTACCAGGGAAAACAGCAGAAGCCTTCTAGTGGCAATCCTACTTCAACTGATTCAAATCCTAAAAGCAAGGTTCAGTCGAAGAATCAGAATACT
CAACCTCTTCCTCCTCTGATGAGTTTACCTAACTCACCGGTGGCTTCAATGTATGCTGCTAATGGAATGTACAACAGCAATGCCTACGGTGGCTTTTGGT
ATGGATCCCAGTTTTATGGGCCAGGAATGTATGGTGGGTGGAATAATCTGTCGGATGGAAAATACAAGCCCCGAGGGAGGACAGCGTATGGATCGTATGG
ATTTCCCAATGAAAACTTGGATGGTTTGAATGAGTTGAAGAGAGGACCACGGAGTGGACTCTCTAATAACCAACAGGGCTTTGGACCTGCTGCTGCAACA
GCTGTCAAAGCACAGGATGTTTCTGCTACTGATGGTTCTAATGCAGTTGTGCAGGATCAGTACAACGGGTCTGACTTAGCTGACACTTATGAAAATGCCA
AATGCTTTATTATTAAGTCGTACAGCGAGGATGATGTTCACAAGAGCATCAAGTACAATGTTTGGGCTAGCACACCTAATGGAAATAAAAAGCTTGACAG
TGCTTATCTGGAAGCTAAATCTGTCAATTCTCCTGTATTCCTTCTCTTCTCTGTTAACACCAGTGGGCAGTTTGTTGGTCTCGNCCGAGATGGTTGGCCA
GGTTGATTTTGACAAGACGGTGGAACACTGGCAGCAAGACAAGTGGACTGGTTGCTTCCCTGTCAAGTGGCACATTGTCAAGGATATTCCCAACAACTTG
TTAAAGCATATCATTCTCGAGTATAATGAAAACAAACCAGTGACAAACAGCAGAGATACACAGGAGGTCAAGCTCGAGCAAGGCCTTCAGGTGTTGAAGA
TTTTCAAGGATCATGTCTCCAAAACATCCATCCTGGATGACTTCAGCTTTTATGATAACCGTGAGAAGATAATGCAAGAGAGGAAATCACAGCGGCAGCA
ACAACTGAAGAAGATCACGAGTCCGAAGCTGCTGCCTACTGTTGACAACACTGAAAATGATTCCGGCAATGCGCAGGAATCGCAGAAGCCTGAAGTTACC
GGAGAGAACAAATCTGTGGTGGAAGACAATGTGGAGGCGGCTGCCGTGAGTGGCGTTGCCCCGAAAGATGCTAACCCCACAGCCGCAAGCTTGGCTGTCG
CGAATGGCTGCTGATTTTTTTGTCTGTTGAGTTGTGAGTAAGGTGACATGACAGCTTGGGAGTTTTGGAGGAGGCTGGCGCAGTTCAACTGTTGGAGGCA
ATCAGGGTTCTGTTGGGGTTCTGTAGGTGTTTTTGCAGAAAGTTTGAGGGATATGGTTAGGTTTCTCTTGAGATTTCCCCCCTGTATTATTATTTCTCTA
TCTTGGAGTTGAGTTCGGCTGGTAGGAGATAGAGATCATCATTTGTTGATCTGGGGTGGTGGTGTGTTGTCTTTTTTATCTTGTCGTCGGTAGAAAATGT
ACCTAGGTGTGGTGATTTGTACTGGTTTTGCAAGAAGTAACTTGTCTGTTTCAGAGT
page-top