Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23961  (registered. 2007)
Contig Information
Length 1904 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Beta-amylase; AltName: Full=1,4-alpha-D-glucan maltohydrolase >gi|1771782|emb|CAA67128.1| beta-amylase [Triticum aestivum]
Score 1441
Evalue 0
Total Hit Count 332
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23961
TTTTTTTTTTAACAGCAGAAGCCTGGACGGCAGTTCCATTTATACGGCTAAAAACTTCACGATCATTAAGTTACAAGCACAAACTGTTTTATTTATTCAC
TCGAATACACACAGCAAAGTGGGGCGGAAGTTCCTATGAACTGCAGCTCATCGGAAAAGCATACAACCTCATGTTACCAGTACAATAGTATTGCCACACT
ATATGGCTATAACATTGTAGCACACAGTTTATTTATCCTCGGCGGCTTATTTCCTGCGCACCTCAATTCTCACAAGTGCCTCTTGACCCTCTCGTAGACT
GCATAAGTGATGCACATTATTTTATGAAGGTAGAGAAAGATTTCTACACAGGGGCAAGGAGCACCTCATCCCCGACATCAGTGTGATCTTTAACTGGCAG
GTCGGTGTTCTTATCAAAGGGGAATGGCTCCAGTTTTGGCTGCGCTGCTTTCAGGATCATTTCAATTGGCATTTCTGGCTTTGATCTTTCCAAAGGCGCC
ACTGGATCAACACTTGGGTCATGACCCAGGTTAGCATGCATTTTCTCAACAAAAGTTTGGAAAGTGGCATAGTTCTGTCCCTCCAGTAGCTCATTCGATA
ACCGGAGGTAGGTGAACCCAAACAGTTTGTGCTCAGGAGGGCCATTCTTGTTGATGCCTTTCGGTCTCGCGTTCCTGAGTATTGTGTTGTAAGCAGTGGC
ATCAAATCGACCGAGTGCGTTTTCGCACGCCACATGTAAACCCTCTCTCCATCCAGCACTCAGCACCTGTTGGACTAGTTCTTCTGGTGCGCTCTTCGCC
TCTTCGCTTTGCTCCGAGTCCCTCATCTCTGCACAAGTGAAGTTCATGCTAGCATGATGCCTTGTGAGCATGCGTGCTATGGTTCTGTAGCCGTCTCTGT
CATCTAAGTTGTAGTACCCGGCTGTGAGCTCGGCTGCATGGTTTGGAACCCTGTACCACCAGTGAATGCCAGAGATTTTTATTGCCAGCTGCACCCTGCA
TCCCAAGAAGACCTTGTTTGCTTCGTCCAAGACCTTGTCACCGTGCTTGATCAGTTTGTTGGAGTACCATGACAGGAAAAACTTCCCCTTCTCGGTGAGG
TATGTTCCGTTGTCCTTGAAGAATTGGGTTTTCTCGGGAGTGTCGTTGTACTCTCCCAGCATCGTCTGGCAATTCCCACTCAGGATGGCCAGCCTTTGCC
GCTGCTGCTTTGAAGTCTGCTTCCAGGTACTTGTCATAACAGATGAATTCTCCGACGCCCGGGAAGACCCATCCCTGGCTCTGAGGATAGGATGGGTACC
TCATCTCTCCAGCCGGGCCAAGTCCCACTTCAATGTCCACGATGGTACCGGCATCCAAGAACTTTTTCATGTTTTCCCTGAAGCTCGTCATGTAATCAGC
ATACATCTGGACGGCTGTTCTTCCATGGAAGAGAGGCTGGTCATCCACTCCAAGGGTGAGGTACTCGATGTTCCTCGTCCCGCCCCGGTTGGTGTAGAAA
ATGTCCGGGTCGGTGGCGCCGACGTCGCGCACCCACTGTGGGATGGGGATGTTGACGATGTCTACGACGTTGCCACCGCACTGGTGGAACGACATGATGG
CCTGCAGCTTGAGCCCGGCCTCGTGCACCAGGTCGAAGACCTGCTTGTAGGCGCTCCAGTCGTACGCCTTGGGGCCCTTGCCCTCCACCAGCCCCCACCA
GACGTCTATCATGACGCCGTCCACGCCGGCCTCCGTCAGCTTCTTCAGCTGCGCCCTGGTCTCATCGCCCTTCTCGAACTTGTTGTCGACGCTCACGACG
TCCAGCGGCAGCATAACGTAGACTTGGACATAGTTGGCTAGCATGTTCCCAGCCATTGCGGCTGCTGGCTACAAACACTGGTTTGCGTGCTCACTCACTC
ACCG
page-top