Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23928  (registered. 2007)
Contig Information
Length 1658 bp
Clones 22 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 6
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 5
Wh_RDr Root of dessiccated seed 4
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phenylalanine ammonia-lyase [Hordeum vulgare subsp. vulgare]
Score 2273
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23928
TCACGGCACGTCCGTGGGCTCTGCGCTCGCGGCCACGGTGCTGTTCGACTGCAACGTCCTTGCTGTTCTCTCCGAGGTCCTGTCCGCCGTCTTCTGCGAG
GTGATGAACGGCAAGCCCGAGTTCACCGACCACCTCACCCACAAGCTCAAGCACCACCCCGGCTCCATCGAGGCCGCGGCCATCATGGAGCACATCCTGG
CCGGCAGCGCCTTCATGGGCCACGCCAAGAAGGTCAACGAGATTGACACGCAGCTCAAGCCCAAGCAAGACAGGTACGCGCTCCGCACGTCGCCCCAGTG
GCTCGGCCCCCAGATCGAGGTCATCCGGTCTGCCACCAAGTCCATCGAGCGCGAGGTCAACTCCGTCAACGACAACCCCGTCATCGACGTCCACCGTGGC
AAGGCGCTCCATGGCGGCAACTTCCAGGGCACACCCATCGGTGTGTCCATGGACAACACCCGTCTCGCCATCGCCAACATTGGCAAGCTCATGTTCGCGC
AGTTCTCGGAGCTCGTCAACGAGTTCTACAACAACGGGCTGACCTCCAACCTGGCAGGCAGCCGCAACCCGAGCCTGGACTACGGCTTCAAGGGCACCGA
AATCGCCATGGCTTCCTACTGCTCTGAGCTCCAGTACCTTGCCAACCCGGTGACCAATCATGTCCAGAGTGCCGAGCAGCACAACCAGGACGTGAACTCT
CTGGGCCTTGTGTCGGCCAGGAAGACCGCCGAGGCTGTGGACATCCTCAAGCTCATGTCCTCCACATACATGGTGGCGCTGTGCCAGGCCATCGACCTCC
GCCACCTGGAGGAGAACATCAAGACCTCCGTGAAGAACTGCGTGACGCAGGTGTCGAAGAAGGTGCTGACCATGAACCCCACCGGCGACCTCTCCAGCGC
GCGCTTCAGCGAGAAGAGCCTCATCACCGCCATCGACCGCGAGGCCGTGTTCAGCTACGCCGACGACGCCTGCAGCGCCAACTACCCACTGATGCAGAAG
CTGCGCGCCGTGCTCGTGGACCACGCGCTCACCGCCGGCCCCGGCGAAGCCGAGAGCGAGGCCACGGTGTTCTCCAAGATCAACAAGTTCGAGGAGGAGC
TGCGGTCGGCCCTGCCGCGGGAGATCGAGGCCGCCCGCGTGGCCTTCGAGAACGGCACCGCGCCCATCCCCAACCTGATCAAGGAGAGCAGGTCGTTCCC
GCTGTACCGCTTCGTCCGCGAGGAGCTCGGCTGCGTGTACCTCACCGGCGAGAAGCTGCTGTCCCCCGGCGAGGAGTGCACCAAGGTCTTCCTGGGCATC
AGCCAGAACAAGCTCATCGACCCCATGCTGGAGTGCCTCAAGGAGTGGAACGGCGAGCCCCTGCCCATCAACGTCTGAAGCATCGTCCGCGCCACCGTGG
AGGAGAGGAGGAGGAGGAGGAGGCTTCCAGAGTACATCCAAAAATAAGACGCTTAATTCGTTCGTGCATGTTCTTCTTCAGTTCCTATCGCCTTTTGCCT
TTGGTTGTTCGTGCGTTGGTGTTGATCGACGTGTGGCGTTGTTGTTGATTGTGTAGCTGCTCTGCCGCAGCTTTACCTAAAGATATTGTCGTTGTATTTT
GGGGTGAATCATGCTAATACTATGTGGCTTCTTTTTTGCTTGTATTATTATTACTGTC
page-top