Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23918  (registered. 2007)
Contig Information
Length 812 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 6
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 4
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08839 [Oryza sativa Indica Group]
Score 535
Evalue 9.32531e-53
Total Hit Count 77
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23918
TTTTTTTTTTCAACAAACATCCATGAGGAACAAGTTAATGAAAAGTATGATTCCAGCATGGCTATCCAAATTTATGGTTCTGAGACACATTCGCAAGAAC
GTTTTGCAGGAACAGTGTTCATGATGATCTTTATCGCATAAAGACCTATTTTACTCGAACTAGATCTGAAGCAGGTAAGTGATAACAGAACGCTAGCGAA
ATCCGGATCGCGATCTCAAACATCCACACTACAAAGGAAGAAGAACACGGAACGCATGCATCACAGGTTTGTATCTAGGAACATAAACGCGGGAGAAGAC
GGAGCAACGGCACCGTCGGCCTGCCGGGGCCGGGACGCGACGGGGAGGAGGGGATCAGTCGTCGCGCTTCTTGAGCTTGTCGACGCGCTGCTGGAGGTGG
TCGAGCTTGACGACGAGGGAGGTGACGGAGAAGAGGATCCAGTAGAGGAGCAGCGCGGCGGCGATGAGGAGGGCGTTGCGCTGGGACTTCATGATGGACT
TCTGGTGGCGGAGGTGCTCGGAGGGGGTGCAGGCGTGCTCGTCGTCGCAGGTGGGCCGCATCTCGTACTTCCAGTAGATGTCCATGAGCAGGAAGAGGCA
GAAGGGCACCACCGACATCATGGGCTTGAGCGCGCTCCGCACCACGGAGATCATCCCGCGCCGGAGCGCGTCGAGGCCCGGGAGGGTCAGCAGCAGCAGC
ATGATGGCCTCCGCGCCCGCCGCGTACCCCAGCACCACCCACTCCAGCGCCATCGCGGCCGGATCTCGCGCCTTCCGATTCGCCGGAGATCGCTTTGCTT
GGGAGAGGGGAT
page-top