Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23891  (registered. 2007)
Contig Information
Length 1793 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 4
Wh_KMP Shoot grown under continuous light 5
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 4
Wh_VSCB Liquid cultured tissue 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit beta tubulin 5 [Hordeum vulgare subsp. vulgare]
Score 1918
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23891
CCCCCTTCCCCCGCAACCACCACCACCACCGTCCACCGGACCACCGTCACCGGCGGCGGCGAAGGCACGATGAGGGAGATCCTGCACATCCAGGGCGGGC
AGTGCGGGAACCAGATCGGGGCCAAGTTCTGGGAGGTGATCTGCGACGAGCACGGGATCGACGGGACGGGGCGCTACGCGGGGGACTCGGACCTGCAGCT
GGAGCGGATCAACGCTCTACTACAACGAGGCCAGCGGGGGCCGGTTCGTGCCCCGCGCCGTGCTCATGGACCTCGAGCCCGGCACCATGGACTCGGTGCG
CTCCGGCCCCTTCGGCCAGATCTTCCGCCCCGACAACTTCGTCTTCGGCCAGTCCGGCGCCGGCAACAACTGGGCCAAGGGTCACTACACCGAGGGCGCC
GAGCTCATCGACTCCGTCCTCGACGTCGTCCGCAAGGAGGCCGAGAACTGCGACTGCCTCCAGGGATTCCAAGTTTGCCATTCTTTGGGAGGAGGCACTG
GATCTGGGATGGGCACCCTTCTTATTTCTAAGATTAGGGAGGAGTACCCTGACCGAATGATGCTGACCTTCTCTGTCTTCCCATCACCAAAGGTCTCAGA
CACCGTCGTTGAGCCATACAATGCTACACTTTCCGTTCACCAACTCGTTGAGAACGCTGATGAGTGTATGGTGCTTGACAATGAAGCTCTATACGACATA
TGTTTCCGCACGCTAAAGCTTGCCACCCCTTCCTTTGGTGACCTGAACCATCTTATCTCTGCTACCATGAGCGGTGTCACATGCTGCCTGAGGTTCCCTG
GACAACTCAACTCCGATCTTCGCAAGCTTGCTGTCAATCTCATCCCATTCCCCCGTCTCCACTTCTTCATGGTTGGCTTCGCGCCGCTGACGTCACGTGG
GTCACAAATGTACCGTGCTCTCACAGTCCCTGAGCTGACTCAGCAAATGTGGGATGCCAAGAACATGATGTGTGCCGCAGACCCCCGCCACGGCCGCTAC
CTCACCGCCTCGGCCTGCTTCCGAGGGAAGATGAGCACCAAGGAGGTGGACGAGCAGATGCTCAACGTCCAGAACAAGAACTCGTCCTACTTTGTGGAGT
GGATCCCCAACAACGTCAAGTCGAGCGTGTGCGACATGCCGCCCAGGGGGCTGAAGATGGCGGGCACCTTCGTCGGCAACTCCACGTCCATCCAGGAGAT
GTTCCGCAGGGTGAGCGAGCAGTTCACGGCCATGTTCAGGAGGAAGGCCTTCTTGCACTGGTACACGGGTGAGGGCATGGACGAGATGGAGTTCACCGAG
GCCGAGAGCAACATGAACGACCTCGTCGCCGAGTACCAGCAGTACCAGGACGCGACCGCCGACGAGGAGTACGACGAGGAGGAGGAAGAGGAACGCGACG
CGGAGTAGCGGCGCCGGATGTGCCCTGCTCCCCAACCCAGCTATATGTCCCCCGGTTCAGGTCTGTCGCCATGGCCAGGTCGCGTTTCCTCCGGTGAGGG
TTTGTGTGGTTTCCTCGTGTGGCTTGGACGAGTCGAGGTTGCGTCGTCTTGTGCTCCGTTTTGTAATTTGCTACGGCTAGTAGTGCGTTGGGAGTCTGTC
TTGTTCCGCGTCCATCCTTTGGTCGGTCGGTCGGTCCATAGCTGACGGCGGCCTCAACTGTCGAGTGCTCTCCTTTTGAGCTGGTCGTCGTCGTCGCCTT
TGTAAGTTCTGACAAGTATTATTGTTAGTCGTTCGCTTCATCAGCAACCAAAAAATCAGTATTGGTAGTGGTTTCTCATTATCTTGTGAATAT
page-top