Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23875  (registered. 2007)
Contig Information
Length 1349 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 9
Wh_V483 Shoot grown under cold condition for 3days 6
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cold acclimation protein WCOR518 [Triticum aestivum]
Score 430
Evalue 3.09561e-40
Total Hit Count 280
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23875
TTTTTTTTTTACACAGTGCAAAACATTTTATTTAAAGGAAAAAACACACTACAAACCAATGGAAGACCACAGTTGATAAAACGTTACACGGTTACTATTT
GATAGACAATTACACTAACAAAATGCATGCATGTTCCACAGCTCCACATCACAAGTAGTTAGAGCTGCACATGCATGTAGATATTATTACATAAGTGACT
CCCAAGAGATTTAATGGCTGTATTGCATGCAGATGCAGGTGATACTCATAGCACTATAGTACTTGATGGAGCTTAACTAGGGCACTGGAAGTCGTCGGGC
ACTGTCTTGCCACATTGGTTGACGAGCACCTCGATGGCGATGGGCAGCACGAGGTTGATGTTGAGCGCCTTGAGCTTGATGGTGGTGCAGAGGCATAGGG
CTGCGTCGAGGTCAGCCACACCGGATAACAGCGGGCAACATTTGTCGCTGGCACTGCTGCCGATTAGTGCGTGCACCAGCCCGTTGAGTGCGTCCACGCA
CCCCAACAGTTTCAGCGTGTCGATGGGGCACTTGCCCGTTGATGACGATGGCGGTGGCGTCGCTGGGACTGGGGCCGGGGCCACAGGGGATGGTGGCGTT
GGTGGTGTAATTGGTGTCGGCGATGGCGGAGTAACCGGTGTAATAGGTGGTGTAATTGGTGTCGGCGATGGCGGAGTAACCGGTGTAACAGGGGTGGGCG
GCATTACTGGTGGGGATGGCGGCATCACCGGTGTCGGCGATGGTGGAGTCGCAGGGCATTGGAAGTCGCTGGGCACTGTCTTGCCGCATTGGTTCACGAG
CACTTGGATGGCAATTGGCAGCACGAGGTTGATGTTGAGCGCCTTGAGCTCGATGGTGGTGCAGAGGCAGAGCGCGGCGTCGAGGCCGGCCACACCGGAC
AAGAGTGGGCAACATGTGTCGCTGGCACTGCTGCCGATCACCGTGTGCACCAGTCCATTGAGTGCGTCCACACACCCTAGCAACTTCAGTGTGTCAACTG
GGCATTTGCCCATCGGCGGTGATGGTGGAGTAACCGGAGTCGGTGGTGGAGTGATAGGAGATGGTGGTGTAGGCGAAGGAGTGATAGGAGTCGGCGGTGT
TGCAGGCGGTGATGGAGATGGCGGGGTTTTCGGTGTAGGCGAAGGAGTAACAGGGGTCGGTGGTGGGGTGACAGGCGATCGGTGGCGTTTTCGGTGTAGG
AGAAGGAGTAACAGGGGTCGGTGGTGGGGTGACAGGGGATGGCGGCGTTTTTGGTGTAGGCGAAGGAGTAACAGGGGTCGGTGGTGGGGTGACAGGCGAT
GGCGGCGTCATAGGGCATTGGAAATCGCTAGGCACTGTCTGCCGCACTG
page-top