Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23853  (registered. 2007)
Contig Information
Length 1307 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit R-SNARE, VAMP72-family [Physcomitrella patens subsp. patens] >gi|162671306|gb|EDQ57860.1| R-SNARE, VAMP72-family [Physcomitrella patens subsp. patens]
Score 420
Evalue 3.44704e-75
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23853
TTTTTTTTTTCAGAATGTACAGATAATCGAGTGACGTCCCCCTCTCTCATAAAGCTTACACAAGTACTCCAGATCCCTATGGTCTTATGGAACATAAGGA
TGGTCTATGAGGAATTAAGGGTCTCACACCACATAACTGTGTTCGGAACATAGCGAAAGCATAATTTGGTGGTCATTATATGCACATGACACGGTAAACA
GAACATCAAATGACAAGGAAAAAAGGGCGAATGAAGACTCTGAACTCTCTAGCACTTGAAGCCCCTGCAAACCATTAGCCAGAGGATGAGGATCAAAAAC
GCGATGCCACCACCGACCATCAGCTTAAACCTCAGGTTCTGAAGCCACATCTTGCGCCTGAGCTCTCTGCCATGCCTATGGAAGCTGTCGGCCTGCGACT
GTAAGGTTTCGGTCTTGCCCACCAAAAGTTCAATCTTCTCGCCACGATCTAATATCTTCTCGATGTTGTCCATCATGATCCCTTTAACCTCTGAAAGATG
TGATTTCACCTTAGAGAGCTTGCTAATTTCCTCTGGATGATTAATACAATACTGCATGTGATCCTTCAACCTTGGCCTGAACTCAGGACAGAGAGAAAAT
GATAAGCAGCACTTGCATGGTAACGAGAACACCAAAGTATATATAACCCAACNAGCAAACAATTCCATACCCGAATTCCCGGTCAAGATTGTAGGCGATG
CTAAACCGGTCCTCAAACAGGAAATCGTCCTCATCCGCATCATCAGCAAGCGGGTGTTGTCCCTCCTCATCGATACTGGACCCATACCTCTGCATGAAGT
CTTCCCTAACCCTCTCTAGGAACACAAACGGCACGCTCCTTCCCAACGCCTCTTCGGCCACCACAAGAAACACAAAACCACGGTCAACGAGGAAGTTGAA
GGTGTGGCCATCGCAGGAGTAGGTGGACCTGGTGCTGTTGGAGGGCAGCTTCTGGAGGCACTGCACGGCGATGGTGCTGAAGTTGCCGGAGAAGGCCGTG
TGCTCGGCCAGCACCACGGAGCCCTTGGCCACGAAGCTGTATATCAGCGTTTGCTTGCTACCACCGTTCATGGCTCCTCCTCCCTCTTCTACCTCCCGAA
ATTAGCCACCGCAGAAGCCCTCGATTGACCCAGATTGATGGGGAATACTAACACAGGATTTATGAATCGGATCAGATCTCGGGGTGGAGGATCAAACTCG
AAGTGAAGGCGGACAGGGAGCTTCGAGGCGGGGTAGGGGAGTACCTTGTAGAGGCTCGTCTAGCGCAGGGGTTGGCCGTCCTCCTCCTCCTCCCCCTCGC
AGTGAAC
page-top