Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23831  (registered. 2007)
Contig Information
Length 893 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195618520|gb|ACG31090.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays] >gi|195629280|gb|ACG36281.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays] >gi|195653101|gb|ACG46018.1| vacuolar ATP synthase 21 kDa proteolipid subunit [Zea mays]
Score 753
Evalue 5.81467e-78
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23831
TTTTTTTTTTATTCTCAAGTTCAATGCTTTTATTCAACAGGCAGTCCACGTTCTGCAAAAGCAATAGCACCTACAAGATGATACCTGGCAGGCATATGGA
GTCTTTACAGTAGGAACAGTATCTCTACGATCAGATGCATCAAGCACCAAAATACGTGATTTACCAAAAACGTGCAAAAGAGAAAAGAATAGATAAGAAA
CAGTTGAACACATGTTGACATTCCAAAGGGCTTCACCCAAAATAATTTACAGAGATTCCCAGATGGATGGAATTAGACTTTCGTTGGCCATGTTGCTTGA
GCTGACATGATTATGCCCACGATCACTCCAAAGAGGCCCAAAGCACTGCCAAAGATCTCAATCACCAGGATCTTTACAAAGAGTGTTGAATTCTGGGCAT
CAGACAGTGCACAGCTGCTTCCGATTATTCCCACGCATACCCCGCAAACAAGATTAGCAAAGCCGACAATAAGACCTGAGGCAAAGATTGCATAACCAGC
TCGCATAGACTCTGGATCATGCATTCGGGATGTTGGCACACTTTCAAGCTTTGTTTGGAGGATGATCGCCACGATTACACCATAAATTGCAACGGCCTCA
CAGAAGATGACACTGATGAGGTTCTTGGAGGTGATCCTGGGCGCCTTGATGGCGGCCCCGATGAGGCTGCTCCCCGTGATGAAGATCCCCCATGCTGCGC
CGAGTACAGAGACGCCGATGGAGACGGCGATGCCGATGGCGGAGAAGGTGTAGGGCGAGATATGCACGAGCGCGCGCGCCCACGACGACGAGTAGTCCGA
CGACATCCTCCCACCACGATCTCCACCGGTGCGAGCTCGGTGCTGGATCGGGGATTTTTTTTTCTCTCTCTCTCTCTTTGCGATGGTTGGATC
page-top