Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23830  (registered. 2007)
Contig Information
Length 728 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit retrotransposon protein, putative, Ty1-copia subclass [Oryza sativa (japonica cultivar-group)]
Score 663
Evalue 1.09625e-67
Total Hit Count 354
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23830
AACTTTATCACAAGAACAAGCATAAGATTCTCCCAGGCGGGCAGATAATTTAAAAGCTCAGACAATTAACCATTGTACCATAATAGCATTCGATCTACTT
CGAAGTCTTGCATAACAAACACAGGGAGGGTATCATAATTCAAAACTGTAGCCAAATTCTACTACCGAACACGATTGCATAGAGGGGACTTCATCTGATC
AGAATTCGGCAGGAACAGTTCCAGCAACCTGGTCCAGATCGCGCCTTCCCTGGGAGGTGATGAGCCTTCCACCCTTGGGGTCGACATCAATGATGCCCAT
CTTCTGCAACTCCTGGAGGATGTTGCGGGAAACAGCACCACTGCTCTTGCAAAAGTGCGGTGGGCGTGAACCGTTCCTCTGACGGCCACCGTAGATCTTC
TGGAAGCCGCCGATCCCGATTCCCTGCCTCAGGTAGATCTTCCTTGCCATCGAGGCAGCCCTGATGTAGTACCAGTCAGCATCAGAAGGTGGCAGCTCCT
TGAACCTTGCAGTCTTGACAATGTCAACCCACTCTGGAAGCTCCATCTTGCCGGAGCGCTTGAGGTGCGCGGAGTAGGCCTTGACGAACTCGTGGGGGTT
GACATCCTTCACCGTGCGCGCGGTGGAGGCCGCGGTCTCGGCTGCGGGAGCGGGGACGGTCGCCATCCTGTGCTCTGGCCGACGGCGGCGCTGTCTTCAG
GAAGGAGGGAGAGGGGTGCGCGCCGCTG
page-top