Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23829  (registered. 2007)
Contig Information
Length 731 bp
Clones 21 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 7
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosome-like protein [Zea mays]
Score 459
Evalue 4.99985e-44
Total Hit Count 368
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23829
ACGATCTGATAAATAGTATATGCTTTGCATTCGCAACATGTGCCGAATCTTGAAGTAAAAAAAAAAGTAGTAGTACAGAAGTATACGGAATGGAGATTGC
ATTAGCTAACATTTGGTACAATTAAATAGTACAATTGAACTGGAAAGGGCGGCTGGTGACTCATATAGTTTGTGCCATGCAGGCAAAAGAAGATCTCGAA
TTGCCAGAGCTGTGCATCTAAAGTTGTTATGAATTCCGTCATCATTCCATTCACAGAATACCGCTAACCTCCCAGTTGTCGTTGTCCTCGTCGCGGCGGG
TTCTCACAGCCTCTGAGTCTCCCTCATCTTCGGGGAACCTACGATCATCCATCATACGCCTGCGGCGGTTGCGGCGGCCGGCCTCGCGGGCCTTGCGGAT
CTTCTTGTCCTTGGTGTTCTCGTGCCGCCGGCGGCGCTTGATCTCCTGGAGCAGGCCGGCCTTCATCACCTCCCGCCGGAAGCGCCGGAAGATGGAGTCC
TCCCCCTCGTTCTCGTCCACCACGATCTGCACGTTGTAGCCCTTGGCGGCCAGCACGGGCGTCGGCGCGCGGCGGGCGGTCATGTGGACCGCCGAAGGCG
CGGAGCTCTTCCCCGAGAACGGAGCCAGGGGAAGCTGGAGCAGGGCCCTTAGCATGGAAGTGCCGGTAGGGGCGGCCATGGCTGTGGCCTTCGACTAGTC
GGCTCTGACGGTTGCTGCGCTCTCTTTGAGT
page-top