Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23821  (registered. 2007)
Contig Information
Length 1646 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 3
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_SHDr Shoot grown with dessication 1
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_031062 [Oryza sativa (japonica cultivar-group)]
Score 737
Evalue 1.01328e-75
Total Hit Count 443
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23821
ACCAGCAGCATCAGGAGCACCTGCTGCAGCAAGCCCCCAAGCTTCAACCACTCCTACCAGTGGCCCTGCAGGTGGTCTTGGAGGCTTATTTCCAGGCCTT
GGTGCTACTGGAGCTGCTAGTGGCAGGCCAGCAGGTTTATTTGGGGCTGGACTTCCGGAATTAGATCAAATGCAGCAACAGTTGAGCCAGAATCCCAACC
TTATGAGGGAGATAATGAACATGCCAATGATGCAGAGCCTCATGAATAACCCTGATCTAATACGCAATATGATTATGAATAATCCACAAATGCGTGATAT
TATTGATCGGAATCCAGATCTTGCCCATGTCCTCAATGATCCTAGTGTTCTCCGCCAGACCCTTGAAGCTGCAAGAAACCCTGAAATTATGAGGGAGATG
ATGCGGAACACAGACAGAGCAATGAGCAACATCGAAGCTTCCCCTGAAGGGTTTAATATGCTCCGGCGTATGTATGAAACTGTACAGGAGCCTTTTCTTA
ATGCAACAACAATGGGAGGGGGTGGGGAAGGCACCCCGGCCTCTAACCCGTTTGCAGCTCTTCTTGGAAATCAGGGGCCTAACCAAGCCGGCAATGCTGC
TACAATGCTCCAACTACCGGCCCAGAGTCCACAACAGGAACCCCTGTTCCAAATACTAATCCACTTCCAAACCCCTGGAGCAACAATGCTGGGGGTGCGC
AAGGAACACCACGGTCAGGTCCTGCTGCTAGTACCAGGGCTGGTGCAACTGGTGGCCCAGGAGGGCTGGGTTCAGCAGATTTGAGCAGCCTGCTCGGTGG
TCTTGGTGGGAATGCAAGAACTGGTGCTGCAGGTGGTCTAGGAGGGTTGGGTTCAGCAGATTTGGGGAGTATGCTTGGTGGTCCACCTGATGCTGCTCTT
TTGAGTCAGATGCTGCAAAACCCTGCTATGATGCAGATGATGCAGAACATTATGTCTGACCCACAGTCAATGAACCAGTTGCTTAGCATGAACCCAAATG
CACGCAGCCTGATGGAGTCAAACACTCAGTTGAGGGATATGTTCCAAAACCCAGAATTTCTTCGCCAGATGGCATCCCCAGAGGCTTTGCAGCAATTACT
CTCATTACAGCAGACAATGTCATCACAGCTTGGCCAAAATCAACCTAGCCAGGCTGGTAACCTAGGAGGCAATGGCACAGGCACGCGGGGAAATGTTGGT
CTGGACACCTTGATGGGCATGCTTAGTGGGCTTGGTGCTGGAGGTGGCTTAGGTGTACCAAATGCCTCCAATGTGCCACCGGAGGAACTCTATGCAACGC
AACTCGGCCAGCTCCAAGAAATGGGGTTCTTCGACACCGCAGAGAATATCCGGGCGCTGATGGCCACTTCTGGGAACGTACATGCTGCTGTGGAGCGCCT
TCTCGGGAACTTTGGCCAGTAGATAAAACGAGCCAGATACTGCCCGTAATCTCCCTGTTTTAGCCAACAGGCAGTGTCCGTCTACAGTAAAAAAAGACAG
AATAATACAGTTAACTTTTTCCCGTACATGGTCGTCATGCCTTTGTTTTTTCAGTGTTGTATTGACAATTTGGATTGATGTACATACATCAGATGATCCG
GTGTTACCGCAAAGAATGTGGCTCTAGTTTTCCTTTAAAAAAAAAA
page-top