Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23811  (registered. 2007)
Contig Information
Length 1619 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 6
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0557600 [Oryza sativa (japonica cultivar-group)] >gi|42407947|dbj|BAD09086.1| monodehydroascorbate reductase [Oryza sativa Japonica Group] >gi|113624455|dbj|BAF24400.1| Os08g0557600 [Oryza sativa (japonica cultivar-group)] >gi|215734842|dbj|BAG95564.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1913
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23811
GATATACGTATAACCTAAAAGAATGTAGAACCAGAGATGCTACTAAATTTATTCGGATTCTGCCATAGTGGTCACAGCAACACCATCAAACTCCAATGAA
AAATCGAATCACACTTCTGAACTAGGAACTAGGAAGCATCGGCAGGGGAGGGACAAACACAAAATTTACACGCGTAGAATAGATAAGAGGAATCTTCAGA
TCTTGGTGGCGAAATCAAGGCCTTCCTTGCCGAGCGCCTCCACGTCGGCCACCGGCGGCTGGGCCCTGGCGACCTTGGCGATGGCCTGATTCTCGTCGGC
GGAGCCACCCTCTAGGAACACACCGATGACCTTGCCGTCCTTGACCCAGTAGGTGCCGAACTTGGGCTTAGGCGCCGCTGGGTCGTTGTCCCCGAACAGC
ACCGTCTCGCCAACGTTGTCGCCGTAGAACTGCCACGCGACGTCGAACGACCTCGAGTAGAAGTAGGGCAGGTAGTCGTACTCCGCCACGGACTCGCCGG
ACTCCTTGGCCTTGATCGCCTTTACTGCCTGCTCGGCTGATTTCCGAGCATGGTCGACGTGCTCCACTCTCCTCGGCTCGTCGTACAGCTTCATGGGGAA
AGTCGCCACATCACCGATGGCATATACACCAGCGACGCTTGTTTCGAAGAATGTGTCAGTCTTGAGTCCACCCTTCTCCTCTTCAACTTGGCCTTTGAAG
AGGCCTGTCAGCGGCCTGCCACCGACTCCGACGATGACAATGTCCGCATCCAGTACTCTTCCATCCTTCAGCTTCACCACACTAACATCTCCATTGGCAT
CAGCATCAAAACCACTGGCCACAGTACCCTTCACGATATTGATTCCTTTGCTAGCGTAGTAACCCTCGTAGAAATGAGCAATGCCGGCAGTGAAGAGACG
GGGCATGCACCACGGCTCTGGGTACACCATAGTGACATCGAAATTGTTGATCTTCAGTGCTGCGCTGAGCTCAAGTCCTATGTAGCCACCTCCAACAACG
ACGGCCTTCCCATCCTTCTTTGCTTGCATAGCTGCGACCAACTTGTCGGCGTCATCAATTTCCCTTAGATACAATATGTTGTTTGATTCTGCTCCTTGAA
CGCCAAAGTCAATGAGCTTTATGGTCGAGGAGCCAGTGGCAATGAGCAAGGTCTCATAGGTGAAGGTTGCTCCAGCTGCACTGGTCAATGTCTTGGAGGC
AAGATCAGCCTTGACAATTTCGGTGCTCAGGATCAGCTTAATGCCTTTTTCCGTGTACCATTCGGGCAAGAGCTTCTCCCCGCCGCCCCCGACGCAGGTG
TGGAATCCTGGAAGCCTGGCGGCATTCTGGGGAAAGAGGTAGCCCTTGCTGAGCGCAGGGCGCTCATACGGAGCCACGGACTCCTTGGAGATGATGGCGA
GCTCCCCGGGCTGGACGCCCTGCTTGCCGAACTCCCTCGCGGCGTATCCCGCCGCGACGCCGCCGCCGAGGATGACGTACTTGAAGTGCTTCTCCGACGC
CATCTCCCCGACAGATCGATGGATGGAGCGCAGCAGCGAATTGCGAGGAAGAAACGGAAGGGCGGAGGAGAGGGGAGGAGGAGAGGAAGGTGGGAGGAAA
ACGCGGCCGTTCGCTGCGG
page-top