Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23810  (registered. 2007)
Contig Information
Length 945 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19723 [Oryza sativa Indica Group]
Score 526
Evalue 1.33436e-51
Total Hit Count 364
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23810
ATTTGCAGAAAACACAGAACCCACTGAGAAACCAACCCAGGGATTTGTTCCAATGCATGAAAAAGAAGCTCATTCGACATTGCCTCAGGTCTTTGCTAAT
ACAGAGCAGCTCAAAGTTCACACACATGACCACCAAACGTTACAACTCATGTATTCCCATGTAAACAAGGAAAAACTGACAGAATATCACAGGCTGGGCC
CGGCTAGTTCGTCAGTTCCATGATAGCACTGACTATGTCACCGTCAGCAGATTTGAGCGCCTTCACAGCCTTGGGCCTAGGCACACCGGCCTGGGTCATC
ACCAGTTCAATGTCCTTAGGCTCAACTCCAGTCTCATCACAATCCTCGTCATCCTCCTGAACAGCTGTAGAAGCCTCAGGGTTTGAGATGACGCTGCTAA
GATCAGGCGCTTTGAATTGCTCGGCAGCCTGGGACTGCAGCTGTGAGCTCAGATCCTCAATCTTAGCCTCACCGAAAATGACATAGGTGTCAGAGGCAGG
GCTCTTGAATACATCTGGCTTGGAGATGACAAACAGGATATTCTTGCTCTTCTTGACAGTTACACGGCTCACGCCAGTGATAGTCTTCATGCCAAGCTTC
AGCATGGCCTTCCTGCTCTTCTTCTCACTCCTACTCTGCTTAGATCTTCCACTTGCATCAACTCCCTCAACATCATCATCTTTGTCATCCTCGTCATCAT
CATCCTCATCTTCCTCATCATCATCATCCTCAACTACGGGCTCGTCTCCCTGCGCAGCGAGCTTCTGCTCTTCCAGAACGGCGCGGAGCAGCTCCGCCTG
CGTCGCGGTCTCGGCCGTCATGGTGGTTGGGTGGGCGGGTGGAGGCGCCGGCGCTGCTGGAGAAACCCTAGAACCCTAAGTTGGAAAGTGGGGGCTGTGG
AGGCGGAAGCAAAAGCGGCACGAGGCCTCGTGCCNNAATTCCTGC
page-top