Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23802  (registered. 2007)
Contig Information
Length 1362 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 5
Wh_SHDr Shoot grown with dessication 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gamma-type tonoplast intrinsic protein [Triticum aestivum]
Score 1182
Evalue 1.98742e-127
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23802
TTTTTTTTTTATGTGTCACATATTTAATAAAAAAAGAAGTGTTTGTGGTAACTAGCTAAGTTATCAGAACATCACACACTTTAAGAAACAATGAGTCTAT
AACCTAATAAATACATTGTTGCATGTTCCTATCTACTGTGGAGATAGTAACATAGTCTAGAAAAGTGGTGTGTAAGTTACTAGACTATGTTCTTGCCCAT
TATGACCTGCCTCAAACAAACTAAACAGTAGTGGACCTCACTGGCAATCTCAGACGGACGGATTAATTCCAGAATTCAAGTTTTCAGAGGCACGGTCGAA
CTCAACTCAACTTGAAATTACTCGGGCGGGACGGGCGAATTCACAGTTTTACAGAAGCAAATTGACAGTGTCGTCCACGGTTTTACAGCTCCACGAACTC
ACCACAAACTGATCGACCCAGGAAGCAAACTTAAACGACTCATGGTGATGGCAAGGAAGGAGACGACGCGATCATAGATCACACGGACGGACGGGCAGGC
AGGCGGCGGGCTTGCACGCAAGCAAGCAGGCTGGCTGCGCTGAGCTCGCTGCTCAGTAGTCGGTGGTGGGGAGCTGCTCGTGGGTGCGGGAGATGAAGAG
CAGCTCGTAGATGACGCCGGCGAGGCCGCCGCCGATGAGGGGGCCGACCCAGTACACCCACTGGTACCCCCACTCCCAGCTGACGAGGGCGGGGCCGAAG
GAGACGGCGGGGTTCATGGACGCGCCGGAGAAGGCGCCGCCCACCAGGATGTTGGCGCCCACGATGAAGCCGATGGCGATGGGCGCGATGGTGCCCAGGC
TGCCCTTCTTGGGGTCCACGGCCGTGGCGTACACCGTGTACACCAGCCCGAAGGTCATCACGATCTCCAGCACCACCGCCTCCCACGCGCCGATGCCACT
CAGCCCGAAGGTGCCGGTGGGGAGCCCGCCGGTGGAGAAGCGGAGGAGGAAGCAGGCGGCGGTGGAGCCCAGCAGCTGCGCGATCCAGTAGAGCAGGCCG
CGGAAGAGGGTGATGTTGCCGCCCACGAAGGCGCCGAAGGTCACGGCCGGGTTCACGTGCCCGCCGGAGATGTTGGCGCCCACGGACACCGCCACGAACA
GCGCGAAGGCGTGGGCTATCGCCGCCGAGATGAGGCCGGCGGGGGTCGCCGCGCCGTCGGGGCTCAGCTTGCTGAAGGCCATGCCGGAGCCCTGGCCGGC
GAAGACGAAGATGAGCGTGGAGATGAACTCGGCGAGCGCCGCCTTGAGGGCGCCCACCTCGTACACCTCACGGTGGCTCCCCACGGCGATCCTGCTGACC
GGCATTTTCGCTCACCTCCGAGCCTAGCTCGCTCGCTCGCTGGAGAAGAAGAAGAAGAGACT
page-top