Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11894  (registered. 2012)
Contig Information
Length 1769 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_DPA20 Seed DPA20 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_RDr Root of dessiccated seed 1
Wh_VWD Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XA Root 1
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115476070|ref|NP_001061631.1|| Os08g0359500 [Oryza sativa (japonica cultivar-group)]
Score 346
Evalue 6.00E-93
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11894
TTTTTTTTTTAACAACAGAGGTAAATATTGAAGTTGTTCATTTGAAACCAATTCTGCTCAGCAGGTTACAAGATTCACGTACACAATAAAGTTGGTGCTG
AGCTGCTGGCTGACTACAATACTGAAGTGTGGTATATGATATACATGAGACAGTGACATAAACCAAGGATGTCATCACAACTTGCTGGACGGTACACCTA
CACCAGAGGCCCTAACCTTCTTCTCGATCACCTTTGAGAGCTCCTTCACTTCCTCCTTGGGGATGTGGCGAGGGTGACTCAACCAAAGCCCTCCATCAAC
CACCATTGTAGTCCCATTTACATATTTGCCTGCATCGGAAGCAAGATAGAGCGCGGCCATTGCTATATCCCGTGTCTCCCCCAACTTAAATAAAGGCATC
ATTTCCCTTTTCCCCTTGCCCATTTCATCAGGTGCAAGCTTCCTTAGTCCTGGAGTGCCGCCGATTGGTCCTGGTGCAATTCCATTGACCCTAATTTCAT
AATCTGTTCCCCATTCCAGAGCCAGCGTTCTTGTGATACTATCAACACCTGCCTTAGCGGCGGAGACATGAATTTGGTACCAAGAAGCAGTGTAATGCAG
TGTCGCGCTTATGTTAATGATGAGGCCACCAGTGGAGGGACCTCTCCCTGGCCCACCTTTTTTCAGATACTTCAGGGCTTCATAGCACATTGTGTATGTA
CCCACAGTGTCAATCTCAAGAACTGTTCCCTCGTGCCGAATTCGGCACGAGGCAAAACCTCTCAAAACCCTCGTTCTCCCCACTCCCCGCCTCCGCCGCC
GCCGCCGCCGGTGCCTAGCAAGATGAGTCGGCACCCTGAAGTCAGGTGGGCTCAAAGGATTGACAAGGTGTATATCACAGTACAATTGCCTGACGCAAAG
GATGCCAAGGTCAAGCTGGAACCTGATGGTGTATTCTCTTTCTTTGCCACTGCTGGAACTGATGGGAACTCCTATGAATCAAAACTGGATTTGAATGACA
AAGTGAATGTCGAGGCAAGCAAAGTAAGTGTTGGTGTCAGGTCCATATTCTGTATTTTGGAAAAAGCCGACGCCAAATGGTGGAATAAGCTTGTTCCAGA
TGATCAGAAGGCACCACACTTCGTGAAAGTTGATTGGGACAAATGGGTCGATGAAGATGATGATGGTGCTGATGTTAATGTTGATGGGATGGACTTTTCG
AATATGGGTGGCATGGGCGGTATGCCTGGCATGGAAGGTTTGGGCGGCATGGGTGGCATGCCCGGCATGGAAGGTTTGGGTGGCATGGGTGGTATGGGTG
GTCTGGCTGGTATGATGGGTGGAATGGGCGGTATGGGTGGTATGGGCATGCCGCCTGGTATGGAAGGTTTGGGTGGTATGGGGATGGATGATTTTGAGGA
TGAGAGTGACGACGAAGGAGAAGTGTCGAAACCTCAAGACGCAGGGAAGTCTGATGCTGCGGAAATCTCCGAGGTGGAAGGCAAAGCTGGCACAGCTGCT
CAGAGCAACTGAAGGCTTTCTACTCAATAATCCCTACTCGACTGTATCCTAGCGTTTTTTTATCAACGTGCTAAACTGAAGGACACATTCTGCTCGCTGG
TTGTGATTGGTGTCTCATGTAAGATGTTAACTTATACTTTGTGTCCAACTAAGCTTCGTACCGTCTGCTGGCATATTACGAGTTCTGAGATTGTTTGCAT
TGTACGCTGATGGTTCTGCACTCTGTTTGGCTTAAAATGTGTTTACCCTAGTTTTTTCCAAAAAAAAAA
page-top