Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23775  (registered. 2007)
Contig Information
Length 1402 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1417
Evalue 1.15494e-154
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23775
GTACATCAAACACCCGATCCTCAAACGACAAAAATAATCTTGGGTACATCTTGGATTACTCTAGTGGAATCAACAGAAACAAAGTGGACGATACACAGGT
CTCCATATACAGTAACATGCAGTTCTAACCTCAGCCAGTCGGCCTGCAGGCTAGCTAACAGTAGATTCTTACACAACGAATAAAATGCCGATTCGTGTAT
GACTATATAAAACCAATGCCAAGGGATGTAAAACATGATGTCTCTTCATGGGGGCCAAGTGAAGTGATTTACAGGAACACGTCCTTCTCGAGCAGCTTGA
GGACCTCGTCCTGGTTGTTGAGCTTGGCGACGTCGATGGGCGTCTTCCCATCCATGTTTTGGAGAGTGACAGCAGCACCGTGCTTCAACAGAAGATCCAC
ACACTCTTTCCGGCCATAGCCAGCAGCGTAATGCAGTGGGGTGTTCTTGTTCTTATCCATGGCATCTACAGCAGCACCCGCCTCAAGGAGGATTTCCGCA
CACTTGAACTCACCATATCCACATGCAAAGTGCAAGGCCCTTCTTCCCTCAGAGTCTTCTTCATCCTTGTCTGCTCCACCATCTAGAGCCTTCTTCAGAC
CCTCACCGTCACCAACACTGGCAGTGTGGTGGACAATGGATTCGTCTTCATCTTCACCTTCTTCTTCAGTTTCTTCAGTACCAGAAGGTTCAGCAGTAGA
GACAGTGCTAAACGGCATGGTAGTTCCCATTGCCTGGCCAATCTTTTGAAGAGTTTCAGGGTCATTCCAGTACTTTATCATTGCAGCAGGACCACCATTC
TCTAACTCATCAAGAATTGGCTTCAAGGCTGGATCTTCCTTAATCCGAGACATGCGCTCTTCAAGCTCCTCCTTATGTGTTGGACTAGTCAAATTTTCCA
GCATACTGGACATAGCAGGATCCTGCATAAGAGCAGTCCCGAGGCGCTCTGCCATTGTCATAAACTGAGGGTTTTCCATGACCTTTTGCATTGTTTCCAT
GTATTGATGAGGATCCAATGGAGGCATGCCCTGTTCTCCTGCAGTCTGAGCACCTTTCTGTAGCTGCTCAGCCATCTGATTGAATGCAGGGTCCCTTGCA
ATCTGGTCTGCCATCTCCTTTATAGATGGATCATTGAGCAAACTTTGCATAGAAGAAAAATCGAAAGGACCCGACAAGCCTGCAGCGGCAGCTGGAGGAA
CCCCTTGACGTTCGTTGGATGATCCTTCTGTTTTCGTACTTTTGCTCTCATCAGCAAACCCGGATGGGAGATCTCCACCCGACGCCATCGCGGTAGATAC
GAGGAGTAGGGGAAGAAGAATTCGTCCGAGGTGGCCTGCTTGCGTCTGCCGGAGGCGGAGCTCGGCGGCGCGGTGGGGAAGGAGAGAGTGCTGCCAAGAT
GG
page-top