Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23770  (registered. 2007)
Contig Information
Length 809 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_RDr Root of dessiccated seed 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit blue copper-binding protein homolog [Triticum aestivum]
Score 532
Evalue 2.0623e-52
Total Hit Count 463
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23770
CGCTAGCATCAGCATTCAGCAGCACCTCCCTTCTACCTCCTCTGCTTTGCATTCCTCCTTCCGGTTTCAACCGCAATCAATGGCTGCCATGAAGATCACC
CTCCTTGCCGTGGCCGCCTTATTAGGCACCGCGTCAGCGGTAACCTACAACGTCGGCGAGCAGGGCGGTTGGACCCTCAACACCGACTACAGCAGCTGGG
TGTCCGGCAAGAAGTTCAACGTGGGTGATGAGATCGTCTTCAAGTACTCGTCCGCCGCGCACGATGTGGTCGAGGTCAGCAAGGCCGGCTACGACTCCTG
CAGCATCGACGGCGCCATCAACACCTTCAAATCTGGCAACGACGTCATCCCCCTCAGCGCCACCGGCACCCGCTACTTCATCTGCGGCATCACTGGCCAC
TGCAGCCCCACCGCCGCGGCCAGCATGAAGGTCATGATCGACGTCGCCTCGGGCTCCTCTTCGCCTTCCTCACCCATGCCAGCCGCAGGTCCTGGCGCGA
GCAACTCTCCCCCGGCGCCACCCTCCTCCGCCGCTACCTCCGTCGGTGCCACAGCAGGATTTGGCCTCGTCGCCCTACTGGCGGCTGGTCTCATGGCTTG
AACGCATATATTGATCAGCTGCCACGCGCACATATGAGCTTATATATTGTTAACTACTGCTGTAGTCATTATCACGGGTGAATACATGTATTCTTTTTTA
GAGTGAGAATGTGATAGTTACTTGTATCTATCACGTCTATATGTAATCTGCAGACCTTCATGTCTTTTATATAATCATTCTAGAGCATTATTTTATACTA
AAAAAAAAA
page-top