Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23763  (registered. 2007)
Contig Information
Length 1551 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GDP-mannose 3,5-epimerase 1 [Zea mays]
Score 1908
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23763
ATCGCGGGAAGTCCATCCATCCACCCACCCACCCAGGGCCGCACACCGCCGCCTCACCTCCTTTGTCCCCCTCCCGCCAGCTCCACGAGAAAAAGGTAGA
CCACGCCACCGCCGCCGCCGCCGCCGCTGTCATCGCCGGCTCCGCCTCCTTCCCGCCGCCGACTGTCCCGACAACTCCCGCAAGAATGGGGAGCACCGAC
GAGACTGGGACTCCCTATGGCGAGTACACCTATGCTGAGCTGGAGAGGGAGCTGTACTGGCCATCCGAGAAGCTGAGGATCTCGGTTACTGGAGCTGGTG
GTTTCATTGGATCCCATATCGCTCGCCGCCTGAAGAGTGAGGGGCACTACATCATTGCCTCTGACTGGAAGAAGAACGAGCATATGACCGAGGACATGTT
CTGCCATGAGTTCCACCTTGCTGACCTCAGGGTCATGGACAACTGCCTTAAGGTCACCACCAACGTCGACCATGTCTTCAATCTCGCTGCTGATATGGGA
GGCATGGGCTTCATTCAGTCCAACCACTCTGTTATCATGTACAACAACACCATGATCAGCTTCAACATGCTTGAGGCCGGGCGTATCAACGGCGTGAAGA
GGTTCTTCTATGCCTCGAGCGCATGCATCTACCCTGAATTCAAACAGCTTGAGACAAATGTGAGCTTGAAGGAAGCTGATGCCTGGCCTGCTGAGCCACA
AGATGCCTATGGCTTGGAGAAGCTCGCGACCGAGGAGCTGTGCAAGCACTACACCAAGGACTTTGACATCGAGTGCCGTATTGGCCGTTTTCACAACATT
TACGGTCCCTTTGGAACATGGAAAGGCGGTCGCGAGAAGGCACCAGCTGCCTTCTGTAGAAAGGCTCAGACCTCCACCGAACAGTTCGAGATGTGGGGTG
ATGGTCTCCAGACTCGATCGTTCACTTTTATCGACGAGTGCGTCGAGGGTGTTCTGAGATTGACAAAGTCGGACTTCTGCGAGCCCGTGAACATCGGAAG
CGATGAAATGGTGAGCATGAACGAGATGGCTGAGATTGTTCTCGGCTTCGAGGACAAGAAGCTGCCCATCCACCACATCCCTGGTCCAGAGGGTGTCCGT
GGCCGCAACTCTGACAACACCCTCATCAAGGAGAAGCTTGGGTGGGCCCCCACAATGAGGCTCAAGGATGGCCTAAGGTTCACCTACTTCTGGATCAAGG
AGCAGATTGAGAAGGAGAGGACCGAGGGGAAGGACGTCGCCCTGTATGGATCGTCCAAGGTGGTGTCCACACAGGCGCCCGTGCAGCTGGGCTCCCTCCG
CGCGGCTGACGGCAAGGAGTAAACAAGTATGCAGATCAACGCCAGGCCTATTATGCGCCACTGCCCATCGATCGGAGCCTTCCTTGCAAAGACATTCAGA
GAGAATAGCACAGCCTGTCCTACCTACCCCATGCGCGATTTTTAGCAGATTCTAGTGCTCCTATTCATTGTCGCCCCCGTCAATTATTATCTTTGTGTCA
CCGAATTCCTGGTATACCGAACTTTTGATTGGATGAAGAATAAGATCCCCT
page-top