Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23760  (registered. 2007)
Contig Information
Length 1022 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_VHS Shoot with heat shock treatment 16
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 16.9a kDa heat-shock protein [Triticum monococcum]
Score 610
Evalue 2.77855e-61
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23760
ATATATATACATGTACAGGTGTGGAACATATGCAGAAAACCCATTATACAACGGGATAAATACAAAGGGGTACATGACCTATATTATAACTCTAACAGTT
CCCATTTGCGAGGCAGCCATTTTTAGCCACTCAACGAATATTTCGAGCAACCTCAGAAAACGAGAAAAAAAAGATCATTTTTCTCCTGATCCTTTCCATC
CGAACTACAAGCAAAGAAAAAAAGGGTCAAATTTTGTGTATGCAAAATCTGCATTGCACTTAAAAACAGAAGGGTTTATTTTTCATTTATTCATCGCCAA
ATCTGTTGGCGATTACACAAGAACATACACGGCTGGGGAAAGAAACGCACTACAGAGATGTCTCATCAGACTCGGCAAGACGAAGACACAACTATAGCAT
ACTTTCAGGTTGCAGAACTCGCACACATTAACCAAACTGGCTCCAACCCTGATGATCATTCGCAGAGACGCATTCACTCAGCCGGAGATCTGGATGGCCT
TCACCTCGGGCTTCTTGACCTCGGCCTTGGGCACGGTGACGGTGAGCACACCGTTCTCCAGCCCGGCCTTCACCTCCTCCACCTTGGCGTCCTCCGGCAG
CCGGAACCGCCTGACGAACTTGCCGCTGCTGCGCTCCACGCGGTGCCACTTGTCGTTCTTGTCCTCCTTTTCCTTGGTGCGCTCGCCGCTGACGACGAGC
ACGTTGCCGTCCTCCACCTCCACCTTGACCTCCTCCTTCTTCACGCCTGGAAGGTCGGCCTTGAAGACGTGCGCCTCGGGGGTCTCCTTCCAGTCCATGC
GAGCATTGGCGAACGCGGCCGTCTCGCTGCTGCCACCTGAGATCGCCGGGACGATGGAGCGGAAGGTGTCGAAGGGGTCCGCCCAGAGGTCGGCGAAGGG
GTCGAAGACGTTGCTCCGCCGCACGATCGACATTGCTGGTGTTGATTGCTTCGGGTTGTGAGCTCAGAAAATTCTGTATCGGATCGTTGGTAGGAATATG
ATACTGCTGGCTTTTGCTTGAC
page-top