Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23751  (registered. 2007)
Contig Information
Length 571 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0589500 [Oryza sativa (japonica cultivar-group)] >gi|38346711|emb|CAE04861.2| OSJNBa0086O06.9 [Oryza sativa (japonica cultivar-group)] >gi|113565269|dbj|BAF15612.1| Os04g0589500 [Oryza sativa (japonica cultivar-group)] >gi|218195459|gb|EEC77886.1| hypothetical protein OsI_17176 [Oryza sativa Indica Group]
Score 197
Evalue 6.77388e-14
Total Hit Count 42
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23751
CGGTCTCCCTCCCTCCCTCCCTATCGTCTGTTTCCTTCGGCCGAAAAGCTCCCCGTTCCCTGCCCCTGCTCCGCCCCTCGTCCCCAGCCTCCGCTCCGCT
CTTGGTAATTGGATACATGGCCTCACCCGCCACACCGACACAGTCCACCGGCGCCCAGGAGGAGGCCGCGGCCCGCCAGTCGCTCATCGGGATCTCCCAG
TCCACCCCGGCAGCAGGGGAGGCCCTCAGCGTCAAGTCGCCGAACGGCCGCACGGAACACGGGCAGGACGACAGCGGGGCGGCCGACAAGTCCAGGTCGA
TGCTCATGTCCATCTCCAACCAGTCCCCGGAGGCTCGCCAGCCCACGCCGTGCCCGCACAGCAACGCCGCTTAAGCTTGATATTAGCCCTGTAATAGTAC
TGATTAGCCCTGCAGCCGCATCTGTCGATATGTTGCGCACCCTTGTGTGGCGCTCTTAATAATCGCCATGTTCCTGGGTTTTCGGTGATGAAATGATATG
CAATGTGGAATACTACTGATTACATAGTTACGTGCATGGGATGCGAGTCTGGTGTTGCTCCAAAAAAAAAA
page-top