Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23726  (registered. 2007)
Contig Information
Length 654 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 6
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 4
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to Leucine-rich repeat-containing protein 53 [Danio rerio]
Score 80
Evalue 3.45821
Total Hit Count 20
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23726
TTTTTTTTTTGATCTTTCTTTTTTGGATCTATCAGAAATTCACCATAAACTTGAGGTAAGGAGGAAGAACAAGAAGGAGAAATAATAATAATAAACAAGG
GAATATAAGAAGGCTAAATATAAGCCTATGCTGACAGGCGAATTTTCACATGCATCAAAAGTTGCCTCAAAACAGATCCAACAAACCAAATCACAACCAC
AACCGAGAAAAAGAGAGCGAGGCCAGACGGCTATCCTATCAGGCAGTACTACATGAAGCAACTATTGGACTGGAGCGAAGGGAAGCAGACGGCCGGGGTG
ATGCGATGGATGGATCGATCAGCGCTTGATGGCCTTGACCTTGTTCCACGTCTTCTTGCCGAAGTCGCCGACGACCCTGACGCCCTTGAGCACCGCCACC
TTCACCTCCATGGTCCGCTCCTTCACCTGCCGCTGGAACCCTCCCATCTCTCTTCTCTTCCCTTCTCTTCTCTTCTCTTCTTGGTCGGAGAGGATTCGTG
TGGCTCGCTGGAGGAGACAAAGAAGACGATGGTGATTGGCGATTTGCCGGGTTGGGTGGCGAAAATGTCGTGCGGATGGTGGTGGGCTAGCACTGGGGAT
ATATAGCCGGTGCGGGTTTGCGTGTAGACCTGAACCAGATGGCGGAGGCTGAGC
page-top