Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23719  (registered. 2007)
Contig Information
Length 804 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 6
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.3 >gi|125524425|gb|EAY72539.1| hypothetical protein OsI_00404 [Oryza sativa Indica Group]
Score 477
Evalue 4.88383e-46
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23719
TGCAGGAATTTGGCACGAGGCCTCGTGCCGCACCTTCAAGCTCATCCACACAAGCACCTCTCGGCTCTCCCGGTCGAAGCATCCGCATCCTCATCCATGG
CCCCCAAGGCAGCCGAGAAGAAGCCGGTGGAGAAGACCCCGGCGGGGAAGAAGCCCAAGGCGGAGAAGAAGGTGCCGGCGTCCAAGGAGGGCGGCGGCGA
CAAGAAGGGCAAGAAGAAGGCCAAGAAGAGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTGCACCCGGACATCGGCATCTCCTCC
AAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTGGCCGGCGAGTCCGCCAAGCTGGCGCGCTACAACAAGAAGCCCACCATCA
CGTCCCGCGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCTGAGGGCACCAAGGCCGTCACCAAGTTCACCTC
CGCCTGATCTGGCCGTCTCCGTTTGTCTTCTTTGATGGATGTATCGGTGTTGCTCTGTAGTAGTTAGCTGTTCGTGCTCTGTCGTGTTGTAGCTTGTGCT
GGTTGTTTTGGATCACATTTCATGATCCGGAGAAATAGTAATTTCAGTTCTTGATATGATCCGCTACTTTGTCTTGGTTCGATCTGTGGTGCGAGCTCGC
CTTTTCTATGTAAATCTCTGCGGCAACGAATCTGAAACTTGCAGATATGTTCCTCTGTTTCAATTCTTAATTTCAGTTTCAGCTAACTGTTTAGAAAAAA
AAAA
page-top