Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23718  (registered. 2007)
Contig Information
Length 1506 bp
Clones 20 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_29072 [Oryza sativa Indica Group]
Score 1864
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23718
CTTTGATCTTTCTATTGTCTGTTGAATTCCACAGAATGCCAAACCATAAGCACAAAAAGGGAAACAAAACAATTGTACAAGGTTAGAAATTGCAGCGCAT
GACATCGGTTTTAGTACCGTAAGACAATTGCCTGTCAAAGAACTCTTATATACAGAAACATGCTACCCTACAATCTTGTAGCTCGGGTTGACAAGATTGT
CTAGGCCTGAGACAACCTGGATTGATTCAATAACGTCCCCAACCTTGAGATCAGCCAAGAAATCCTCATTCTCGGTTACATATCCAAACACCGAATACCG
TCCGTCCAATATATTGGAATTGCTTGGCGTCAGCTCACTTTCTTTCAAGAGCCAGAAGACTTGACTAGAAGCGGAGTTGTCATCAAATTCTTCTCTAGCC
ATTGCCATCGTTCCAAATGCATTAAAAGGAAGCTTTGTTTGAGCCTTGTAAAGACCAAGTTCCTCAAGTGTTTCACCATATATAGGCGCCTTGTCACCAT
CAACCATTATCTCAAGAGGTATGGTACGACTCTTGCCAGTACTGGGATCAATAAAACCCTCGGCTGGTCCCTCGGGATCTCCCGTCTGAACAACAAAACC
ATCAGCTCTTTGGATTTCCATGCCATCATAGAACTTCCGTTCCACCAGATCTACGAAGTTCCCAGAAGTCACAGGAGCATTATATCCATCCAGAACTATC
CGAAATACACAATCTTCTACGTTTGGATTATCTTTAATCTTAACCGTCATATCCACAGTAGCTCTTCCTTTAAGAAGAGGCATGTTGTTGTATTCTTCTG
GTACTTCATAGGGGAAGCCATCAACCATATCTTCTTCTACAGTTCCAACATAATTGAGAAGCTCTTTCTGCTTTGGAGCTACCGCATTCCTGTTTCTATC
CTCAATAATTCGTTGAAGCTCTTCAAGTCCAACAGCTAATTTATCCAATGTTTTTTCTCCGTTTGCTCTTTTTGATTCAGCAAGACCCGAAAGTATTAAA
CTCCTCCCATTAGTCAGCGCTCTTGAGGCCTGCCTCACATTTCTTTCAACTGAATCCAACGCTCTAACACCAGAAACTTTGAGACTATCGGTAATATCCT
CTAGCGGTTTTTGAACTTCACGAATAGCTTTATTATCTATGGGCAAAGCATATCTCAACAAAGCACCTGGATCTTTAATGGGAGGTCCAGAAATAAGAAC
TGAAATATCAGGAATTACAGGTTCGAGAGGATAAGCATGGGCCGACCATCCAAATGTTGGTGGGACAGTAATTAATCCAACAGACAATGCTACAGAAATT
GCACATTCTTTCCAGCTAAATGAGTTTCCTTTCCCGCCGGAGAGCGCACACCGGGCGACGGAGCTTCGGCGGCGATCAATGGTAAGAAGCGAAGGGCGGC
GGCAGCAGCGGGAGGAGGCGAGCGCCGCGGCCATGCGGTGGGGAGGGGATGGGGGTACGGTTCCGATGAAGCAAGGCGTTGGTGGAAGACCGATGGAAGC
GGAGCG
page-top