Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23712  (registered. 2007)
Contig Information
Length 753 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 6
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative 30S ribosomal protein S13 [Oryza sativa (japonica cultivar-group)] >gi|108710647|gb|ABF98442.1| 30S ribosomal protein S13, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|164375541|gb|ABY52938.1| chloroplast 30S ribosomal protein S13 precursor [Oryza sativa Japonica Group]
Score 733
Evalue 8.86061e-76
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23712
TTTTTTTTTTGATGATTTAGAATCAGTGCATATATAACAGAAGAGATGTCATGACTATAAACTTTGCAGCAGCATCCGACCATATCCCCACAATTCATCT
ACGACGGAATGGAAACTTGAAACGGAGTACCGAATGGTGGTAGCGCCGTGATGTAGCAAACAAAAACCAAACAGGAGGCAAATACACATGGCAGTGTCAC
TTATTCGTCGGAGGACGAAGCCGACTTCTTCTTGGCGACGGAAGCCCTCTTCCCCTTGAGCGTCCTGCAGTTGTTCTTTGTCCTCTGGCCACGGACCGGG
AGGCCGAGCTTGTGCCGGATGCCCTTGTAGCACCGGATCTCCTTCATCCTCTCAATCGCCACACGGTTGAACCGTTTAAGGTCTCCTTCAATCATGTACT
TGGTGACCTCCTTACGGAGCGTGATGACCTCCTCCTCGGAGAGGTCCTTGGTGACCTTGTTGTCGAAGCTGAGGTCCAAAAGGATCTGGCGGGAGCGGTT
CCGCCCGATGCCATGGATGTACTGCAGCGAGTACTCCACCCTCTTGTGGTTTGGGATCTCAACACCACCGATACGGATGCACTCGATCCGCAGGCCGCCG
TGACCAATGCCTCCCTTCTTGGGGGCGGGGAGGGAGACGGAGGAGGCGCGGCGGCGGGTGGAGAGGGGGAGAGACGAGGTGGCGACGGGGCCGGAGACCA
TGGAGAGGGTCGCCATTTCTGCTGCGCTCGCCCGACGAGGAGGTGCGTGTGTG
page-top