Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23699  (registered. 2007)
Contig Information
Length 729 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 5
Wh_SHDr Shoot grown with dessication 2
Wh_VHS Shoot with heat shock treatment 4
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216899 [Zea mays] >gi|194696944|gb|ACF82556.1| unknown [Zea mays] >gi|195617290|gb|ACG30475.1| 50S ribosomal protein L31 [Zea mays] >gi|195625392|gb|ACG34526.1| 50S ribosomal protein L31 [Zea mays]
Score 557
Evalue 2.14443e-55
Total Hit Count 389
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23699
TTTTTTTTTTGAAATCTCTAAAAAGACGAATATTTATTTGAAATCTCTAAAAAGACAAATATTTAGGAACGGAGGCAGTAGTAGAGAGGGTTGACACATA
CTGGAAAGTAGTAGGAGTATTACTAGAGTCGTTGCGAACATTACCCGAACACCTCGAGGGCAATGCAAATGCAATCCCCGTGAACCAAATCAATCAACGT
GAAGACGGTACAGCGGGAGAATCAAGCCACGCAAACTAGCATAATTGAGTTCGGGAGTGAACAGCAAGAGAAACGCAGCAGGAAGACGAGGAGTAGGAGA
GGCAGCCATCATTTGCGGGTCTCGTCGTCCTCAGGCTCAAACTCCGGGTCGCCGTCAGGGTGCATCTCCAGCCACTGCTCCTTGGTCCAGTACTCCTTGA
CGTGCCCCCACTTCTTGCGGAACTTCTCGATCTGGCTGTCCATGACGACCAGCGCCGAGGAGTCGCCGACGTAGTAGGGGTGGTTGCCCGACCAAACGTC
CACCGAGTACTCCGGCTTCGTGCCCCCCGTCACCAGCACCAGCTCACCGTTGCAGTACACCTTCGCGTCCTCAAAGATCTCCGGGTGCAGCCCCTTCTTC
CGCATCGAGCACCTCATCCCCTGGGAGGGGACGAGGGAGCGGAGGGTGCGGTTTGCGGTTCTCGCGACGGCGGCGGCGCCCGGGGTAGGGAGGAAGGAGG
TGGAGAGGGAGAGCGCCATGGCTGACGAC
page-top