Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23680  (registered. 2007)
Contig Information
Length 2705 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 4
Wh_SHC Shoot grown with cold treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_33136 [Oryza sativa Indica Group]
Score 2136
Evalue 0
Total Hit Count 304
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23680
TTTTTTTTTTCAATGGAATACATAAGTTTAATCAGCGCAAAGGTTTAACAACATCGNTCCATTATTGTTCACACTGAGACATTCATTACTATTATTGTTC
TCACTGAGAATTCAGTAAATTTTGTCACAACAGGTTCTGCCTTAGGATAGCTCTATTATTGTTCTCACTGAGAATTCAATAAATTTTGTCGCAACAGATT
GTGCCTTCGGACTGCAGAACCAGCACACGCACATTCTCACAGTTGCCAAGTCTCCAAGCACTTCAACTCTGAGTTGAACCTGTAAACTTGACCCGGAGAG
GCGCTGATCACGGCAGCATGGTCGCCATAGTGGATCCTCTCAAGCGCAGGCGAATTCCCGCTGCTGCCAGACCATACAAGAGCTTCATGCAGGCTACCTT
CTTTCCAGCAAATGTTAACCGTCAACCCGCCTCGGGCCCTCAAACCTTTAACGCTGCCATGGGGCCACTTGTCGCGGGGCAGAGCAGGGAGCAGGTACAG
ATCACTCCCGGTGCTCTGCACAAGCATTTCGCACAATGCAGCTGGGAATCCAAAATTTGCATCAATCTGGAATGGTGGATGCGCTGTGAACAAATTGCTG
TATAGACCTCCTTCCTTTTCATGCTCGTGCTTTGGGTCTATCAAAGTGATTAGCTGCAGAATCATTTTGTATGCATGCTTACTGTTGTGAAGATGAGCCC
ACAGGGCCATCTTCCATGAAGTAGACCACCCAGGGCCTTTATCACCTCTTTTATAAAGAGTATTGGCTACAGCTTTGCAGAGGTCAGGTGTTTGCTCAAG
TGTCATGGTATGTCCAGGATAAAGACCAAACAGATGAGATACATGCCTGTGCTGAGGTTCGGGATCCTTAAAATCTTGTGCCCATTCCATGATTGTACCA
TCTCTACCAATTTTTATTGGCGGGAGCCTTGGTAGTGCCGCTTTTATCCTCTGAACCACATCAGTGCTGGATTTTCCTAAAATATCAGCAGACAGAAGAA
CAGCTGAGAATACTTCTCTAATAATTGACATGTCCATAGTTGTTGAATAGCTCACAGATGCTTTCTTGCCATCCGGAGCAATAAAATAATGCTCTGGGGA
AGTAGAAGGATTGGTCTCCAGATAGCCATCTTGGCCTTCAATCAACCAGGACAACAGAAAGGAGGCAGATCCTTCCAAAAGTGGATACGCTGTTCTCTCC
AAAAATTCTCTGTCCATTGTAAAACTGTAGTGTTCCCACAGGTGTGTAGCAAGCCATGGCCCACCCATTGGCCATAGAGCCCATGAAGGATCACCAGCAT
CCGGTGATGTTTTTGCCCACAAGTCTGTGACTTGGTGACTGACCCAGCCATTAGCTCCGTAATTCACTTTTGCCGTCTTAGCCCCATTGACCGAAAGGGA
TCCAATGAAGTCGAATAGTGGGTCTTGGCATTCACTAAGGTTGCAAGGAAGTGATGGCCAGTAATTCATTTGAAGATTTATATTTGGATGGGGAGCTGTA
CCCCATGGTGCATTAGTCTCGTTGTTCCATATTCCTTGCAGATTGGAAACCTGAGTTCCAGGCCTCGAACAAGAAATGAGTAGATAGCGCCCCAAACTGA
AACAGAAGTTCTACCAGAGAAGGATCTTCATCATGTCTAAAACTTATAATTCGGTCTACAGTAGGCTTCTCTGAATTATTAAGCTCGTTTAACCTTGAAC
AGTCAACCATCGGTACAGTGCAATCAGATACCTCAGCATCCTGAGAGATATTCTCAGGTAAGTGAGCCAAAGTGCTACCTCCAAGTACACCATTAGAGCC
TCGTGAAAGTTGCAAGGACACGCGCTGGAAAAGACTTTGGTAATCATCCATGTGATAAGCTTTTAGCTGTGCATATGACATGCTCCTAGCCATATTTAAT
GTTGTGAATGCTGATGTCACTGGATCAAGTGTAGATTCAGAAGGCTTGACAAATGGCCCTTCAAATGAGGTTGCAGCTGCAAGGAGCAAAACTGCTGAGT
CGGCACCATCAAGTTTCAGCATCTTATCATTTAATACTTGCACTTGGCCATTGGCACCACTCGTCAGCAGGTAGAGAATAGCACAAAATTTCATCCCCTG
AGGATGATCAGATGCATTGTCATCTCCAGCGGGCTTTTCTCCTGGGCAGCTACCCTCCATGATTATTTCATTTGCATCTGTTACACGAATCCGGTGATCT
AGTGGTGTAGCTAAAGATACTGTACAGGAGACAGCTCCTGGTTTGTTTGCAGAGATTTTAGTCGCGATTACTTGATGTGGATTTGAGGAGAAGTGTTCCC
TTGAGTACAATACTTCCCCAACACTGTATGTGACATTAACTGTTGCAGATTCCAAATCAAGGTATCTTTTATAATTTGTATACTTGATATGCTCACCAAA
GGCAAGATCAATATCACCGAGAGGCTGGTAACTCTGCGTCTCGTCACCAGACAGGCCATAAGCAACAGCTGTAGCTTCAGGATACAGTCCCTTATCAACA
AGGCTCCTTACTTCAGAAAGAACAGTAGGTGCTTGGGGGTTTGTATAATTACCAGGTCCGCCCGTCCATAATGTATCATGGTTGAGCTGGAGCTTCTCGG
AGGTGACGCCGCCCCAGACCAAGGCGCCGAGACGGCCGTTCCCGATCGGCGCCGCGTCGGTGAAGTACCTCGCTGGGGCCGCGAACACCACCTTCAGAGG
CCGCG
page-top