Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23645  (registered. 2007)
Contig Information
Length 1273 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 3
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 3
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_20217 [Oryza sativa Indica Group]
Score 1354
Evalue 2.04375e-147
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23645
TTTTTTTTTTCTAACTCAGGTCGACGAAATCTTCTTTATAGTAAAATCATGAGAAATACAGGATCCGTCAAAAACGTCTGGCGACGCCAATACAAGCTCA
GAGCATGAACCTCGACCAGCAGCTTCATCGTGCTGAAGAACAACAGGGCCACGCCAGCTGCGGAAAGCCTACTGCATCCCTTCCAGCTAATAGATAAAAC
CGGCATGGCTGATTTTTAGACGAGGGCGCTGATTTATACAGTTTTTTCTTCTTATGCTGCAACAGCAAAACCAGAATCTATCGGATGAGAGCACGCGATG
TACAGCGGGGTAGATGTTCGCCCTGGATCTCTACGTCGGCACGACGACGTCGGGAAGCGCGGCGGCCGGCCCGTCGTCGTCGGGCACCTCGGCGTTCTTG
GCGGGCTCTGTGGTCTTGCCATCTTCGTCCTGGAACCCCTGCTTGAAGAGGTCGTAGTTTGTTAGCTCGGCTGCCTTGAAGGGGCGGTCTCCTAGTACCC
TGGTCAGATCGTCCTGGTGGAGGACCTCCTTCTCCAGCAGCAACTCAGCGATGAGAGCCACTTGTTCCTTCTTCTCCGTCAACAGTTCAACTGTCCTTTT
GTAGGCCTTGGCGACCCATTCCCTCACCTCAGTATCGATGATGGATGCGGTTTGGTTGCTGTAAGGCTTGTTCATTTCAAAGCCATCCCCCCGCTGGGGG
AAGGATAGAAGACCAACCTTATCGCTGAAACCATACACAGCAACTTGCGCATATGTCATCTTTGTAACTTTCTCCAGATCATTCTGGGCACCAGTCGAGA
TTCTTCCAATCAAAACCTCCTCTGCAGCTCGGCCACCTAACGTCATGCATGTCATATCAAAGAGCTGCTCCTTTGTCATCAAAAGATTCTCATTTGGTAC
ATACTGTGCAAAGCCTAAAGCAGCTGTTCCACGGGGAACAATTGTCACTTTCAGAAGAGGCTCTGCATGTTCTAAAAACCATCCGGCAACAGCATGCCCA
GCTTCATGGTAAGCAACAGTACGGCGCTCCAGTTTGCTAATTACCTTGTTTTTCTTCTCTAAACCACCAATAATCCTATCAATTGCAGACTCAAAATGCT
GCATTGTAATCTGAGTTTCATCGGTTCTTGCGGCAATCAAAGCAGCTTCATTACAAACATTCGCAATGTCAGCTCCAGCAAACCCAGGTGTCAAAGCAGC
TAGCCTTTGTGAAAAATATGTTGGGTCATTGTCCAGTTTAAGTTTTGTAAGATATATGCGGAATATCTGATCA
page-top