Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23644  (registered. 2007)
Contig Information
Length 1032 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 5
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0402300 [Oryza sativa (japonica cultivar-group)] >gi|50878377|gb|AAT85152.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|50878430|gb|AAT85204.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579044|dbj|BAF17407.1| Os05g0402300 [Oryza sativa (japonica cultivar-group)] >gi|215697746|dbj|BAG91740.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196770|gb|EEC79197.1| hypothetical protein OsI_19905 [Oryza sativa Indica Group]
Score 993
Evalue 1.08808e-105
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23644
AGTTTAACAACACCTCAGGCACATAAACTCACAATAGAACACCTATACATATGGTTGTACTTTGGCCTCATCTCTGGATGATGGCAAAAACTTACTACCA
TGTCTTCCAAGTTATGTAGATAGCAATTCAAAAGACTTGATAAATGTTGGACATATGCCTGGGTTGGCACAAGGTCCTGGTGGTTCAGACAGGACCCATC
AGTTGTCATTCTGCCTGAGCATCTGTAGGATGGTCAGGAACAGGTTGAGGATGTCGAGGTAAAGCTCAACAGACGCCCAGATGTACTCGTCATAAGTGTG
GCGCTTTATCAAGTTCTCAGTGTCGTAGACGATGAAGCCTGAGAAGACTAGAGCTCCAAACCCACCGATCACAGCATTCGATGCAGGTCCAAATGGGAAG
AAGATCTGGGTAAAGCTTATCACGACCAGGATGGTGAGAGCAGAAAACAGAAACGGTCCAAGGTAACTAAATTCCTTGCCCTTCTTTGCGGCCCAGAATG
TGTATGCAGTCAGAGAGACAACCACAGCTGAGGTCAGTACCAATGCTTGAAGCACAATAGTTCCTTCAGTGTTTGCACAAGCCACACCAATGCTGAAGCT
CAAGCACAGAGTGAACAAACCCAAGATAGCAAGATTGTGAGGGTGTCTGTGCTGATAGATGTACAATGGGATCATCAGGATGAAGGGGAGGACGGCGAGC
ACGAGCGCGAGGACGGGCGAGTTGGAGAGCGTGGCGTTGAGGGTGGGGTAGAAGACGGTGATGGCGGAGACGACGGTGGTGAGGACCAGCTGCGCGCAGA
GGATGCCGTAGACCTTGCGGATGAAGCCCCAGCGGAGGGCGTTCTCCCCGCGCGAGATCCCCGGGTAGAGCGTCTCCCCGTTCCCCGCCTCCAGGTCGAT
CGACGACGCCTCCACCTTCTCCTTCATCTCCGGCGCCCGGCGGTAGCCCGACGGTGCCAGCGGCTGCATCTCCGTCGCCGACGCCATCTCTCTCACCGAC
GCTGTCGGTGGTGGGGAATTGGGGATTTCGGT
page-top