Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23625  (registered. 2007)
Contig Information
Length 2195 bp
Clones 19 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 4
Wh_VSCB Liquid cultured tissue 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_015493 [Oryza sativa (japonica cultivar-group)]
Score 2046
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23625
ATTTTGGACTGTTTCTCATGCCTTGGATCTAGAACTGACGGATAGTAGGTATAATGTGCTACCAGGTTGTATGCTACGGCGATTTTGTTGTGCAGCTTGT
TGAGATTTCATATTTCGTGGCCTTTGTCTTCGTGCATTAAAGGATGTTAGTACAATGTTTACGGCATTCATTTATTGAAGCAAATAGTAACTAATTGTCA
TGGGCTTTTTTTTATTGTGGAGCTCCATGACCATGAGCTTTTTTGGTCGATTGGCTGTCCGAGTTCCTGAAGAACAAATCATACGGCCATTGTCTTGTTG
ATTGATGCAGTTTCTCACCTTTTCGCTGCTGATGTTCAGTTCCTTGCTTGATTCTGGATACTGTTAAGTTGTAATAAAATTATCGAAGTATTTTCTGTGC
AAATAGTCAGCAACAAGAGTTAACGTTCCTGTATGAATCTGATGTTGAACTCTGTACCGGTCGCTGTGGTGAAAGTATACATATTGTCTGCTGTTTTTCT
TTTTGATCGAGAATATTTGTGAAACGTTTCAAATAACCTTGTGATTGTTTTGATCTTCATCTCAATATATTTTCCAGGGGCAGCCTTTGAACCTCTGAAC
TTTTGTGTCCTTGGGTCTGCGGTGATAAGTCAGAGAAAACAATGGAAGATTTACAAGATTGCAACTCCAAAAGCCTTGTTGCTGTTCCTGGTTCTCTGGT
TCTGCACCTCTTCAGGCTGTTAGGTCAGCAGGATAATTCCTGGCAGAAGTACGCCTTGGCTTACTTTCTTCTGGTCAGGAATGAGTACTTCCCGAGGGAG
CCAAGGAAACACTCAGCTGTGAATGTGCAACTTGTTCCCTGCTGTGACAGTTCAGATTTGGGCAGTAATGAACTGGAAGTGGAGAAGCAGAATGCTGTTG
TCAAGAGCCAATCAGGAGGTGATTCCAGTTCCAATGGATCAAATGATTGTTTCCTTCCAGGCCTTCATGATGATCTGGCTCAAGACTGCCTTGCCTGGAC
AAGCAGATCAGACTATCCCTCACTCTCTTGTCTGAACAAGAAATTCAATACATTGGTTAACGGTGGATATCTGTACAAGCTGCGGAGGAAATATGGCATT
GTTGAGCATTGGGTGTATCTGGCCTGTAGCGCTATGCCCTGGGAAGCATTCGATCCGTCGCGAAACCGATGGATGAGGCTCCCAAGAATGCCATGTGATG
ACTGCTTCTCCTGTGCGGACAAGGAGTCACTTGCTGTTGGGACACAGCTGCTTGTCTTTGGCCGAGAATATACAGGCCTTGCTATTTGGATGTACAATTT
ACTGACACGCCATTGGTCTCGCTGCACTCCGATGAATTTTCCTCGCTGTCTGTTTGCCTCAGGAAGTTCTGGTGAGATTGCCATTGTTGCTGGTGGGTGT
GATAGGAACGGGCAGGTGCTGAGATCTGCGGAGCTGTACAATTCAGAGGCTGGCCAGTGGGAGACCTTGCCAGACATGAACTTGCCCAGGAGACTCTCCT
CAGGTTTCTTCATGGATGGCAAGTTCTATGTCATCGGGGGTGTGACGAGTGAGAGGCATTCTCTGACTTGTGGAGAGGAATACGATCTCGACACCAGGAC
ATGGAGAAGAATACAGGACATGTACCCCGGAGGAACCAGCGCCTCCCAGTCGCCTCCGCTCATCGCCGTTGTAAATAACCAGCTCTACGCGGCTGACCAG
TCCACAAACGTGGTGAAGAAGTACGACAAGGCAAGCAACACATGGAACATAGTGAAGCCCTTGCCCGTCAGAGCGGACTCTTCCAACGGCTGGGGCCTGG
CTTTCAAGGGATGCGGCGATAGACTGCTGGTCATCGGCGGCCACAGAGGACCTCGCGGCGAGGTGATACTGCTGCATTCCTGGTGCCCGGAAGATGGGAA
CGGCGCCGCCTCCGACTCCGACTGGGAGGTGCTCTCGGTGAAGGAGCGCGCCGGCGTCTTCGTCTACAACTGTGCAATAACGGGGTGCTGAGTTAGCAGC
ACCTTGGCTTCAGTACATGCCACCACTTGTTTAGCAAAACCCACCGATTCGTTGCTGCCATTTTAGCTGCTGCTACTTCTTATAATGACTTGTAATTCAG
AAATGACACCCCCTTTTCGCGGAGCTGTCGATTAAAATGTCGGGTCGAGAGCATAGAGAGCATTCAGTTCAGTTTACCCTGGAACTTCTCTTTAA
page-top