Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11876  (registered. 2012)
Contig Information
Length 1203 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222629957|gb|EEE62089.1|| hypothetical protein OsJ_16873 [Oryza sativa Japonica Group]
Score 704
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11876
CTGCCCCGACCAGGCCGGCCTCGGCTGCGACCTCTGCCGCACCATCCTCGAGTTCGGCCTCCGCATCACCCGCGGCGACGTGTCGACGGACGGGCAGTGG
TGCTACGTGATTTTCTGGGTGGTGCCACGCTCGCCGTCCATCAACGTCCGGTGGGGGAGCCTCAAGAACCGCCTCATGGCCATGTGCCCTTCCTCGTACG
CCATCCCGTTCTACCCTGAAATCACCGAGCCAGGGCCCCCGCAGTTCTACCTCCTCAAGCTCTTCTCGACCGACCGTAGGGGGCTGTTGCACGATGTTAC
GCATATACTGTCGGAGCTAGAGTTTATAATCCAGAGAGTGAAGGTGTCGACCACGCCTGACGGGAGGGTTGTGAACCTCTTCTTTATCACTGATGGCATG
GAACTGTTGCATACGAAGGAAAGGCAAGAAGAGATTTGCTCGATGCTGATTGCTACCTTAGGTCCTTCCCTTACTTGTGAAATCCTATCAGCGGAAGGGT
TCCAGCAAGGATTCTCTTCTCTTCCACCAACAATCTCTGAGGAGCTGTTCAGATTGGAACTAGATGAATGCGAGAGCAGTTCAGGGCCTCTTTCTGCGGA
GATGAAAAAGGTGCAGAAGGCCACCATCAACTTTGACAATTCCTTGAGTCCTGCACACACACTGCTCCAAATTCTTTGTGTTGATCAGAAGGGTCTCCTT
TATGACATGTTGAGAACACTCAAGGACTGCAATATTAAGGTCACTTATGGGAGATTCTGGTCAGACAAGAAAGGTTTTCGCGAGGTCGATCTTTTTATCA
AGCAAGCAGATGGCAAGAAGGTTATTGATCCTGAGAAACAGGATGCTCTGCGGTCCCGCATGAGGTCCGAAATGCTCCATCCTCTTAGGGTGATGATCGT
CAACCGTGGACCGGACACAGAACTCTTTGTTGCCAACCCTGTTGAACTTGCCGGGAAGGGTCGGCCACGGGTGTTCTATGATGCTACTTTGGCTTTGAAA
GCGCTTGGAATCTGCATTTTCTCTGCAGAAATCGGGAGACAGGCAGCATCGGAGCGCCAATGGGAGGTCTACCGATTCCTCCTGGATGACAGCAAAGAAT
TTCCCTTGTCAAACAGCCTAACTAATAGGAACCGTGTTGTTGATAGAGTAAGGAAAACACTGATGGGCTGTTACAACTGAAGACTCGGTTTGTATCTCCA
TGA
page-top