Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23599  (registered. 2007)
Contig Information
Length 1138 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 17
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit aspartic proteinase oryzasin-1 precursor [Zea mays]
Score 1187
Evalue 4.02471e-128
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23599
TTTTTTTTTTGGGACAATTAATAGTAACCATGTCTATATGGAATCATTACTATATCTTGGCCAAATCAAAATATACATACTTATTAATCTCAGACCACAC
ATGCATTATGAAGCATCTATGAGCATGAAATTGGCCTGAAAAGCCGGATCCTCTGCAGCTCATCCGGTCATCTATGCCGCCTTCGCGAAGCCAACCTTCA
TTTTACCATAGTCAAAGACAGTGTGATAGGCTCCCATGAATATATCACCCAAGATCCAGATAGGACCACGGGGAGGAGGAATGTCCATAGCTACGAATCC
ACTGATGCACTTAGTAGCATCTCCCTCGCCAATCTTCAGGATGTATTGCTCTGGTGTGAGTGCAAACTTTTTGCCGCCGATGGAGAAGGCGACGTCAGGC
ATGGATGCAAGTCTTTTGCAGTCCACTGATGATTCTCCCATAGGGCTAGGGATATAGCCACATAGCGTATTAATGTACTTCAATATAAGATCCCGTGTTT
GATCCTGTGCAAGTTGGTTCTTTGCCCACATAACAGCCATCTCACAAACATGGCACACGGCATCATTTGATCTCCCGGTTTCATCATCTACCACAGTCCG
AATACCAAAGCTGCCATTACTTACACCTTGAGTTCCACTGTGAGTGCATAGACCAACAGAAGGACATATTTTTGTTGGGTCGATCTCATTTAGCAATAGA
TCTAGGATCCGTTGCCTGTACTGAGAAGCAACTTCCTTGCACTCTTGGCTGAAAATCCCAGGTGCACCAATCTTTTCATTTATCTGAGTAATTATTGCAG
TGGGACCAACAAGCAACGAAGTTCCCGAATCTGCTATAGCTGCACAGCGAGATGTACATAATCCTGTGGACTTTCCTCCAATCAAGACATCACCCATATC
AAACTGCCAATATCCCTTCTTAGTAACAGGAACGTATTTATGTTCTTCCTTGTGATGCTTAGGATCAATTCCTCCAAACACAATTTCTCCCCCATGCCCT
TCGCCAGCATGCCGGTTGAACCAGAACGAGAAAACAGGGCTACCAACCAGATGTTGGTTAACCATGTTGTACCAGACAGGTTCAACACCGCCCCTAGCGA
TTTCTTTAAATCCAAGACCGAGAATGCCATCGAACTTC
page-top