Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23593  (registered. 2007)
Contig Information
Length 1081 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein phosphatase 2A regulatory A subunit [Lolium perenne]
Score 1309
Evalue 2.65832e-142
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23593
TTTTTTTTTTGGTAAAATCACACCCAACACATGGAATGACAGAAATCAAGTTCAAACTATCAATTTAAGCACACCATCGAAACAACGTGTCTCGTTGCTC
AATTATACAATATTAATAACAACAAAAGGGGAACATAGCCCATCCATTATCAGCATGGAAGTATAGGTAAGTTACTGGGCTAGAAAGAACTCTCGGACTC
TTAAGGGTAAATTACATGTACTCCAAGCTGGACTAAGAATAGCTTCTAAAGAACGTGACGACAGTAGCTTAGTTAGCTAGACATCATGATCTGGTCACAC
GCCTGAAGGGCCTGGTTTGCATAGTATCGTACATCCACATCAGGGTCCTCGCTCAGCTCGACAAGGCATGGCTTCACAGTCTTCTCAGCGACAGATTGAT
CAAGGATTGGTACAAGCGACTGCAGAACTTTCGCAACATTGAATTTGATGTTCGGCACTCTGTCCTTCGAGGAATTAATGACAACAGGGAGCAGCTTTTG
GCATGTTATTTCTGCACCCATGACAGGGGCTAGCAATGAGATAGCTTGCAGGATGGTCATGCGATACAGATAATGTGGGTTGTTTATCTTCTCCAACACC
TGAGGAATTATATGTTGCATTGCCCACTCTGGACCAAACTCCTCCGCCAGGCGCTTCAAGTTGTTTGCGGCAGCTTCTCTGATCGAGAAAACCTTATCTT
CCAACCATTGCATGCAAAGTGCCCCCAGCTTGTCATCAAAAAACCCAACACCTAACTGACTAGCCAGCAGAGGGATGTACTCAATTATTGCAAGGCGAAC
CCTCCAGTGCCTATCCTCCGCAAGTTCTACAATAGCCGGCAATAGAGATTGCGACAGCAAGTCAATTCCAATGACCTGATTAACTTGATCAAGCTTGCTG
ATTATGTTGAGTCGAACATCAGGAAATTCATCCTTCAGCAAAGAAAGAAAAATAGGAAGAAGTTGTTCAATGGTAGCATCCTTCCCCAAGACAGGGGCCA
TTCCCATGATGACTGAAGCCAAAGCTGAGCGAACATGCTGAGACGAATCTGATGACAATTCCTTAACCACCACGGCAGAAT
page-top