Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23591  (registered. 2007)
Contig Information
Length 1071 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Nematostella vectensis] >gi|156212056|gb|EDO33133.1| predicted protein [Nematostella vectensis]
Score 84
Evalue 2.92141
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23591
GCATAGCACCACACAGAATTCAGGTACTTATTAGCAAGTCATATCTTGGTCACAGAACGCAGACTAGAGTGCCAAATCATATAGAGGAAAGGATGGAAGC
TCCACGAGATCGAGCAGCGACCACACACCACCCTGCTTAGATACATCTCAAAGGCTTTCCCTGACCAAACCAAGTTCTGGAAGCCTACACAAAGAGTTTA
GGTAAATTTTTTTTTTGATTCATCAGCCATGGTGAAGCTACTAGCTAGCGCGCGCATTACTTCCACTTCTTGAACTTGCCGCCGCCGCCGAACATGCCGT
GCTTCCCATGCTTGCCGTGCTTGAACTTGCCGTGCCCGTGCTTCCCGTGCTTGAACTTGCCGCCGTGGTGGCCGTACCCGCCGCCGTAGCCTCCATGGCC
GCCCATCATGCCTCCCATCATGTGTCCACCTCCACCGTGGCTGCCGTGAGAGATCTTGTGTGCTCCGTAGGCGGCGGCGGCAGCTGCTGCGCCTCCAGCC
AGCATGCCGCCCATGCCCATGCCTCCTCCTCCATGGCTACCACTGTGACCGGATGAGCCAGGGTAGCCGGCAGGGGGATAGCCATGCTGCTGTGGAGGGT
AGCCATGCTGCTGCGGGGGGTAGCCATGCTGAGGAGGGTACCCTTGTTGTGGAGGGTATCCATGGCCACCAGATGGGTACCCATGACCACCAGACGGGTA
CCCATGACCACCACCATGAGCACCGGCAACGCCGTGCATGATGTTGGAGAGGAGCCCCTTCTCCCCATCAGGGCCTCCCGCTCCAGGTGCAGGAGGGTAA
GCCCCAGGTGCTGGAGGGTATGCCCCAGGTGCAGGTGGGTAAGCTCCAGGTGCAGGCGGGTATCCTTGCTGTGGAGGGTAACCTCCCTGCTGCGGCGGGT
AGCCTCCCTGCTGCGGCGGGTACCCTGCCGGAGGGTATCCCCCCTGGCCACCGGGTGGGTACCCATGACCATCGTTGCCTCCTCCCATTGCTCTGAGGGA
GCTAACTAGAGGAGAAGATCTGCGATTCTGCGAAGCTGAAGAAGAAGAGGCCGATCTGGATGGATGATGGC
page-top