Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23570  (registered. 2007)
Contig Information
Length 1114 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 6
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0399100 [Oryza sativa (japonica cultivar-group)] >gi|113579025|dbj|BAF17388.1| Os05g0399100 [Oryza sativa (japonica cultivar-group)]
Score 920
Evalue 3.58507e-97
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23570
TTTTTTTTTTAAACTGCAAATACCACATTTTATCTGAGTGCAATAGTTTCAGTGTTCAGCACAAGCAGACCCCAAAATGAGCAAGCACACACATACCAGC
AGACCTGCAGCAGACAAAGACGCATGCCCTATAGGCTATAGCTAAGACCATAACATAAACCGTGGATGCTCGCGTGGTGACTCCTGAAGAGTGACACTGG
CTTATTACAAAAGGATGGCCGCCAATTCATTAGGTTCACTTGAGGTTCTTGTTGAACCAGTCAATCATGTCCGCCAGGGCTTCCTCGGCGCTCTTCACAG
CAGCTGCGTCTTCGCTTTTGTATCTCACGGTCCATCCATGAGAAACCCCAGGGAATATCTTGACAAAGTGAGCAATCCCTGAGTTAGAGGATAGAACCTG
CTCGAACTTCTTGACCAATTCTGGTGGGGACATTACGTCAGTTTCAGCTCCAAGTATAGCGATGGGGCATTTCACCTCTTCTATATCATTGACAGTAACA
AATGAAGGGTGCGACATAACGGCTGCCTGGATCTCATTAGCTTTCGCTAACTCTGCAACTACCTTTGCACCCCAGCAATAACCTGCAGCCCCAACGCTAG
ACGCTCCTTGTTCCTTTAGAGCAGCAATAACAGGTTTTGCCTCTTCAAATGCTTTTCCCGGGGTATGCTCCTTTATCCACACTGCTATTGGTCTGTCAGC
GTCTTCAGGTACAAATGGATCCCCATGTAAGAAATCTGGCACCACAACAAAATATCCAGACGAAGCAACTTTATCGGCTATCTTCCTCAGATTCGGCGCT
TCAAAACCGTAGACGTCGGAGATGAGGACGACGGCGGCCTTGGACTCTTTGGCGCCGGCGACGTACGCCTTGATCCCGCCGAAGCTGTCCACGACCTTGC
CCTCGCCGGCGGCGGGGTTGAGCGCCGGTGGGTTCGCGCAGCACTGCGGGCTCGCCATACTGCCGAGGTCACACTGGTGGGGAGGGCTGGAGTGCTGGAG
TAATTGCTTGGCGATGAGATTGGATTGGGATTGGGAACGGGGCCAGGCGACAGCACCGCAGCGGCACGAAATAAATGGGGGGAGAAGGACAGCGGACGCG
TGACTGGCGGCTCG
page-top