Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23538  (registered. 2007)
Contig Information
Length 1937 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_DPA20 Seed DPA20 15
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0484600 [Oryza sativa (japonica cultivar-group)] >gi|4107001|dbj|BAA36299.1| OSK4 [Oryza sativa] >gi|28201242|dbj|BAC56589.1| SnRK1b protein kinase [Oryza sativa Japonica Group] >gi|42409397|dbj|BAD10710.1| serine/threonine protein kinase(OSK4) [Oryza sativa Japonica Group] >gi|113624052|dbj|BAF23997.1| Os08g0484600 [Oryza sativa (japonica cultivar-group)] >gi|215704275|dbj|BAG93115.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215713532|dbj|BAG94669.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201334|gb|EEC83761.1| hypothetical protein OsI_29652 [Oryza sativa Indica Group]
Score 1427
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23538
TTTTTTTTTTAGTCACCCAAACAACACTTTTGGTGCTTCACACAGGGACTAGTCACCCAAACAACACGGTTCGCTGTCAGGGACTGGGTAAAACGAAGAT
GAAACACACCACCTATTTACACACCATCACTTATTCATCTCTGACAGTCACATGTCTCACTATTCATCACTCAACCAGAACAGGCACCAACTTATTCATC
GCTGACGGTCATATGTCTCACTATTCATCACTCAACCAGAACAGGCACCATACTATAGAACCCTAAGGTTGGTAAGGAAGGCCGCGCAAAAATCCAGAAA
GAGGAGCTGAGGTCCAGTAACTCTCTGCATATCTAGCAGGTACTTGTCATCCTTGGTCTTGTAAAGCTGGATTTCAAACTTGATCACGGCAGGTAGCCTC
CCATTAGCATCGCCGTTATCCATGATGGTAGAGTCATCAACAAAGCTGTGGTTGGCATCTAACATATCACTGACCTGAGGAAACCCAGGGCACCACCTGC
ATTTCATGTTGTAGTGTCCATTCTTCTTCCAGCAGACATTTAATTCTTGAAGTGCCTTTAGAACCTCGATCATTATCTCACGAGGTTGAGCTCGAGACTG
GAGCCCAAGAGCCCATTTTCTTTCAACGGGGTAATATGGCCGCAAGCCACTGCCTTGAGAATCATTGCTTGCTGGAAGATACTGCCTGGTACTTGGGCTT
GCTGATTCCAATGAAGTAAACTGATTAAAACTCCTACCCATTGATTGTAGATAGTCAGCCCCCAAATAGCCACTAGTGGCCCGGAACCGATTGTCCAAGA
GTAAGTAATATGCAACAGTTGCCTCATTTTGCAGCCTATTGCACAATGATTCACACACATGGTCTTTATCATATCCCAGGTTGACAATCTCTTTAAGTGT
ATCTTCATCAATCATTTTGGGCTTGCTGCGCCGTGTCTGGTGGAGGCACTGCCAGGTAGCGAGGAAGGCGATTCTGAAACCATGGGTGTTCTCGAATTTC
ACGAATTGTGATTCTCTTCATAGGATCAACAACAAGCATTCTTGGGATCAAATCCCTTGCAAGAGCAGATAAATGACTTGGAAGGATATAGATGCCTCCC
TTTATCTTTTTGAACAGTTTGGGAATATTGTCATCATCAAATGGAAGAGTGCCACAAAGAAGAGCATAAAGTATCACCCCGCAGCTCCAAACATCAACCT
CAGGTCCAGCGTATAATTTACCTGAGATAACCTCTGGTGCAGCATAGTTTGGACTCCCGCAGCTAGTCTTCAGAAAATGGCCATCATGCATGACATTACT
TAACCCAAAGTCGGCAAGTTTCACATTATATTTGGAATCAAGTAACAGGTTTTCTGGCTTTAGATCACGATGAGCAACCATGTTTCTGTGGCAGTATTCA
ACACCAGATATAATCTGCTGGAAGATTCGACGAGCCTCATCTTCCTGTAACCGCCCTTTCTCAACAATGCAGTCGAATAGCTCACCATACTTGCAATATT
CCATCACAACAAATATATCTGTAGGTGTGTAAATGACCTCATAAAGCCGGATGATATGAGGGTGAATTAAGTCAATGAACAACCTCAATATCTTGATCTC
TCTCTTCGCTTTCTCTTCCATTTCCATAGTTCTCATTTGACGACGGTTCAGAATCTTTATAGCAACTTTGTGCCCTGTATGCTTATGCTCTGCAATCCTC
ACTTTTCCAAATGTGCCGATACCTAATGTTCTGCCCACATTGTAGTTCTTTAACGCTTCAGAATGCCCGCCTCCTCTAGTGTTCCCTTCCATTTTCACTG
GCTAAATCGCGTGGTCAGCCGCCCCCGCCCGGACAGAGGAAGGCGCCGGCCCAGTGGAGCGGAGGGCGGCCTCGAATCGAGAGAGGTTTTGGGGTCGATC
GGCTGGTCTGGTCGCTCTCTTCTCCGGGGATGGGACT
page-top