Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11868  (registered. 2012)
Contig Information
Length 817 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222637610|gb|EEE67742.1|| hypothetical protein OsJ_25434 [Oryza sativa Japonica Group]
Score 529
Evalue 2.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11868
GTGAGGACCCAATCCGCTGGAGTCCCCTTACAGATGTTGTTGATGGGTATTCTTCGACACTTCCTCATCTAAAAGGTCTTCAGAACGGGGACACCGCCAC
AAGTGCCATTAAGCAGGTTGCATCTGGACGTTTTGGTGTTACACCAACATTTTTAGTTAATGCCGAACAAATTGAGATAAAGATTGCACAAGGGGCTAAG
CCTGGTGAAGGGGGTCAACTTCCTGGCAAAAAAGTCAGCGCATACATAGCTCGGTTGAGAAACTCCAAACCTGGTGTTCCTCTGATATCCCCACCACCAC
ACCATGACATCTATTCTATTGAGGATCTGGCGCAGCTAATTTTTGACCTACATCAGATCAATCCTAAAGCGAAGGTGTCGGTAAAGCTTGTAGCTGAAGC
AGGAATTGGAACTGTAGCCTCTGGAGTATCTAAGGCAAATGCAGACGTAATTCAGATATCAGGTCATGATGGTGGTACTGGAGCTAGCCCAATTAGCTCA
ATCAAGCATGCTGGGGGTCCTTGGGAACTTGGTCTTACGGAAACACACCAGACACTCATACAAAATGGATTGAGAGAGAGGGTGGTACTTAGGGTGGATG
GTGGATTCAGGAGTGGCCTAGATGTCCTTTTGGCTGCTGCCATGGGTGCTGATGAATATGGCTTTGGTTCTGTAGCTATGATAGCTACCGGATGTGTCAT
GGCACGCATTTGCCACACAAACAATTGCCCAGTTGGAGTTGCTAGTCAGAGAGAGGAGCTACGCGCTNNNTTCCCTGGTGTTCCTGGTGATCTTGTGAAC
TACTTCCTCTTTGTTGC
page-top