Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23531  (registered. 2007)
Contig Information
Length 1202 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit mitochondrial-processing peptidase beta subunit [Zea mays]
Score 1286
Evalue 1.44934e-139
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23531
CAATCTTGGGTTCTGCTGATAATGTCAAGTCTATCACCAAAAAGAATCTCATAGACTACATTCAAAAGCATTACACGGCTTCTAGAATGGTCATTACTGC
TGCTGGTGCTGTTAAGCATGAGGATATTGTACAGCAGGCAAAAGAGCTGTTCAAATCGCTGCCAACCGACCCTACAACAACTAACATGTTGGTTGCTGAA
CAGCCAGCCATTTTTACTGGTTCTGAGGTACGAATCATTGATGATGACATGCCCCTGGCCCAATTTGCTGTTGCCTTCAATGGAGCATCCTGGACAGATC
CTGATTCTATTGCATTAATGGTTATGCAAACTATGCTTGGTTCGTGGAACAAGAGTGCTGGAGGAGGGAAGCACATGGGTTCGGAGCTTGTACAGAGAGT
AGCAATCAATGAAATAGCTGAGAGTATAATGGCATTCAATACAAACTACAAGGACACTGGCCTGTTTGGTGTCTATGCTGTCGCTAAGGCTGATTGCTTG
GATGATTTGGCTTTTGCAATTATGCAAGAGATGAGCAAATTATCATACAGGGTTACCGAAGAGGATGTTATTCGTGCACGCAATCAGCTGAAATCCTCCA
TCCAACTCCACCTTGATGGCTCCACTGCTGTTGTTGAGGATATTGGACGCCAGCAACTCATCTATGGCCGTAGAATTCCTATTCCTGAGCTTTTTGCGAG
AATAGATGCAGTTGATCCGAGCACTATCAGGCGTGTTGCAAACCGCTTCATCTTTGACCAGGATATTGCCATCGCTGCCATGGGACCAATTAAGTCTCTT
CCAGACTACAACTGGTTCAGACGCAGGACCTACATGCTCCGTTACTAGATGATTCGACCAGCGGTGTACCATGTTTACAGTCTGCAAAGGCAAGATGATT
GCTTGTTTTGGCATCAGTATATTAAGGCCACATCCACGCACATTATGTGCCGAAGTGGAGGAATTTTTTGAGTCTTCGTTTTCCTTGCCCCTCTCTTCCT
TTTGCAAACCCACAAAGCTGTCAATAATGGTAGGCAAATTCGACTGACGTGGCTTACTTGGGTGGCCACCCGTTGTTTTACGATGATGATGAATCGTCAC
GATACTTTCCACCTTGTGTTCGGATATTGTTGTCTTTTGGCCAATAATTTTATTGAAGCTGCTTATGTAAAGATGGTGGCTGTTAGCTTCAGAAAAAAAA
AA
page-top