Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11867  (registered. 2012)
Contig Information
Length 895 bp
Clones alternative view 43 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_V483 Shoot grown under cold condition for 3days 3
WH_XI Two-week old seedlingsi22 16L-8Dj 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XE Seedling, infected with leaf rust 6
WH_XF Seedling, infected with leaf rust 5
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115460328|ref|NP_001053764.1|| Os04g0601400 [Oryza sativa (japonica cultivar-group)]
Score 290
Evalue 2.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11867
CCCGGCTGTAAACGTTTCCCATTAGCCAAAGCCAAAAACCAGAATCACACACCACCCGGAGAACTGAGCTGAGATACTACTTCTGTTCTCTTCTCCCCCC
TTTTCCGAGCCCCCCACCCGTCATCTCTCCAGCCTCCAGTCTCCGCCGACGCCATGGGGCAGGTCTGGGCGTCTCTGCAAGAGAAGCTCCAAGGGCGGCA
CTGGAAGGAGAGGCAGGTGCGGAAGATCACCGACAGGGTGTTCGACCGGCTCACCGAGGATACCCAGAAGCCCGAGAAGGACGCCCTCAAGTTCGAGGAG
GTCTACATCGCCGTCCTCTGCGTCTACAATGACATCAACAAGTACTTGCCGGGGCCGCACTACGACCCTCCGTCCAAGGAGAGGCTCAAGGAACTCATGA
AAGAGTTTGACATCGACATGAACGGTCTCCTGGATCGCGAGGAGTTCGCGGAGTTCATCCGGAAGCTGACCGCCGAGTCACTCTGCGCGATCAGCCTCAA
GCTGATCATCACGCTGGTCGCCGCCCCTGCGCTGGCGCTGGCGACCAAGAGGGCAACCGAGGGCGTCCCCGGCGTCGGCAAGGTAGTGCACAAGGTGCCC
AATGCCATCTATGCCGCCGCCATCACCATGGCTGCCGTGCTCATCCAGAGATCCGCCGAGGGCGTCGAGTAGAAGCGGCATCGCGCCGTGAACTGTAGAT
GCACCAGGCAACCAGGGAGGGTGTAAATGTGCTGTGATTTGCCGTGTGAAGGGTGATGCCCTGTGGGACTTATAGTTTTCTGTAATATCTTCCTGTCTGT
GCTTCTTGGTGTTGCTAGCCTGGTGTGATTCAAAAAGACAGTATTCGCTGCTTGTTGACATGATAAATTCTTGGACTAAATAAAGCCGTGGTCCT
page-top