Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23515  (registered. 2007)
Contig Information
Length 1862 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 6
Wh_OKCS Seed DPA5 3
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit legumain [Hordeum vulgare subsp. vulgare]
Score 1085
Evalue 0
Total Hit Count 367
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23515
TTCTGGAATCAGAACCCAGCAAGCACCATCCATGGCGGCCATGTCGTCCTTCCGCCTCCTTCCCCTCGCGCTGCTGCTCGCCATGGCGCACGCGCGGCTG
CAGCCCACCATCCGGCTGCCATCGGACGACGGCTCCGTCGGGACCAGGTGGGCCGTCCTCGTCGCCGGCTCCAGCGGCTACTACAACTACCGCCACCAGG
CGGATATTTGCCACGCCTACCAGATATTGAAGAAGGGTGGTCTCAAGGATGAGAACATCATCGTCTTCATGTACGATGACATTGCGCACAACCTGGAGAA
CCCGAGGCCGGGCGTCATCATCAACCACCCCCAGGGTGGAGATGTCTATGCTGGGGTCCCTAAGGACTACACTGGGAAGGAGGTTAATGTCAAGAACTTG
TTTGCTGTCCTGCTCGGTAATAAAACCGCTGTGAGTGGTGGGAGCGGCAAAGTCGTGGACAGTGGCCCTAATGATCACATTTTTGTGTTTTACAGTGACC
ATGGGGGTCCTGGGGTCATTGGGATGCCTACCTATCCATACGTTTACGGTGACGATCTTGTAGATGTCCTGAAGAAAAAGCACGCTGCTGGAACCTACAA
AAGCCTGGTATTTTATCTTGAAGCCTGTGAAGCTGGGAGCGTCTTTGAGGGGCTTCTGCCAAATGACATCGGTGTCTATGCGACCACCGCGTCGAACGCG
GAGGAGAGCAGTTGGGGAACGTATTGCCCCGGCGAGTACCCTAGCCCTCCGTCCGAATATGACACCTGGCTTGGGCGACCTGTACAGTATTTCTTGGATG
GAAGACAGTGATGTACACAATCTGAGAACTGAATCTCTCAAGCAGCAATATGACTTGGTCAAGAAGAGAACGGCAGCTCAGGACTCATACAGCTATGGTT
CCCATGTGATGCAATACGGTTCTTTGGATCTGAATGATCAACATCTCTTCTTGTACATTGGGTCAAATCCTGCTAACGACAACACTACATTTGTTGAAGA
CAACTCACTGCCGTCCTTCTCAAGAGCTGTTAATCAGAGGGATGCTGATCTTGTCTATTTCTGGCGCAAGTACCAGAAATTGGCTGAGAGCTCCACTGAG
AAAAACGATGCTCGGAAGCAATTGCTCGAGATGATGAGTCATAGATCTCATATTGACAACAGCGTCGAGCTGATTGGAAACCTTCTGTTTGGTTTTGCGG
ATGGTCCAATGGTTCTAAAGACTGTTCGCCCAGCTGGCGAGCCTCTTGCTGATGACTGGAGTTGTCTCAAGTCTATGGTGCGTGCTTTTGAATCACAATG
TGGCTCGTTGGCGCAGTATGGAATGAAGCACATGCGGTCCTTTGCAAACATCTGCAATGCCGGCATCCTTCCTGAAGCGATGGTGAAGATGGCTGCTCAG
GCATGCACCAGCATCCCAACCAACCCCTGGAGTGCCACACACAATGGTTTTAGTGCTTAAACCATAGGTCCAGCAACTTGGCTACTATTTCAGCTATTGT
ACCATATACCAAAGTCCCTTCCTATTCACACAGGGTCAGTAGTGCTTGAACGAACCTTAGATGAATACGAATTATGCCATTACTTCAGCTATTCCCACCA
CACCAAATTACCCTTCCGTGTGCCCCGACTTATAATGTACATACACCATAGTAGGAAGGTGATTTCCTGTGATTGATGTACATATTCGTGATAGCCTGTG
ATCAGATGTGTAGCTCACAATTACATATATGAAGAATGCAAGCGCTGCTATTTTCTACGTAGATTGAGTAATCTCATAGTACTATGAGCTGCTATTTCCC
CATCCATTTGAAACCCTGCAGCTACGTAGACAGCATGACATTGTAAATGAAACGATATGTAG
page-top