Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23506  (registered. 2007)
Contig Information
Length 695 bp
Clones 18 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 3
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0502000 [Oryza sativa (japonica cultivar-group)] >gi|113631817|dbj|BAF25498.1| Os09g0502000 [Oryza sativa (japonica cultivar-group)] >gi|125564262|gb|EAZ09642.1| hypothetical protein OsI_31926 [Oryza sativa Indica Group] >gi|125606230|gb|EAZ45266.1| hypothetical protein OsJ_028749 [Oryza sativa (japonica cultivar-group)] >gi|215767820|dbj|BAH00049.1| unnamed protein product [Oryza sativa Japonica Group]
Score 665
Evalue 5.78993e-68
Total Hit Count 434
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23506
TTTTTTTTTTGATCACCAGAATATAAAGCAGACCCAAACCCCAATTTAACACACGCTTTTCAGCAATTGGCAATCGGATCTAGATTATAAAGGCAATAGT
AGATCTTTGACACATTACAGTCGGCACTGGTAGCAAAAAGGTTGGAATAACAGATACCCCTGACAGTCACAAAACGAACAGCGGAATACTTTCCTACATA
CGAACCAGACCAAAACATACTTCTGACAGACAGTCTACTCGTCCTCCTGGCTGCGGAGCCTGGCAAGCTTGTTCGTAACCACGATGTCGAGCTGAGCAGC
ACGCTCAACAATGTCCTTGCGCTTCTTGGTGGAGACGTTGTGGGCGATCTCCGCACAGTAGGTCCTGTTGTGCATCATAAGCAGCTCCAGCTCAGAGACA
TTGTGGACAACAAACTTCTTGAACTTGTTGGGAAGGTAATGCCTCGTCTTCTTGTCAGAACCGTAGCCAATGTTGGGCATCAAGGTGCATCCCTTGAACT
TTCTCCTGACACGGGAATCGATACCCTTTGGCCTGCGCCAGCTTTGCTTGAGGCCAATGTAGCGGTCGCTATGGGCCCTCTTGAAGTGCTTGACCCTCTT
CTTCACGATCTTCCTCGTCAGAAGCGGCACCGCCATCTTTGATCTTCGGGAGCGAACGACCCTAACCCTAACACGAAGAGCGGAGGAAGAAGAGC
page-top