Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23420  (registered. 2007)
Contig Information
Length 1436 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 5
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit photosystem II CP43 chlorophyll apoprotein [Agrostis stolonifera] >gi|118430374|ref|YP_874639.1| photosystem II CP43 chlorophyll apoprotein [Hordeum vulgare subsp. vulgare] >gi|126302587|sp|P11095|PSBC_HORVU RecName: Full=Photosystem II 44 kDa reaction center protein; AltName: Full=P6 protein; AltName: Full=CP43 >gi|118201028|gb|ABK79399.1| photosystem II CP43 chlorophyll apoprotein [Hordeum vulgare subsp. vulgare] >gi|118201197|gb|ABK79566.1| photosystem II CP43 chlorophyll apoprotein [Agrostis stolonifera]
Score 2071
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23420
CTTGGTGGGCTGGGAATGCCCAGACTTATCAATTTGTCCGGTAAACTACTTGGAGCTCATGTAGCCCATGCCGGATTAATCGTATTCTGGGCCGGAGCAA
TGAACCTATTTGAAGTGGCCCATTTCGTACCAGAAAAGCCCATGTATGAACAAGGGTTGATTTTACTTCCACACTTAGCTACTCTAGGTTGGGGAGTAGG
GCCAGGGGGGGAAGTTCTAGATACTTTTCCGTACTTTGTATCTGGCGTACTTCACCTAATTTCCTCCGCAGTCTTAGGCTTCGGTGGCATTTATCACGCG
CTTCTGGGACCCGAGACTCTTGAGGAATCTTTTCCATTCTTTGGTTATGTCTGGAAAGATAGAAATAAAATGACTACAATTTTGGGTATTCACTTAATTT
TGTTAGGTCTAGGTGCTTTTCTTCTAGTACTCAAGGCTCTTTATTTTGGCGGTGTATATGATACCTGGGCCCCTGGGGGGGGAGATGTAAGAAAAATTAC
CAATTTGACCCTTAGTCCCAGTGTTATATTTGGTTATTTACTAAAATCTCCTTTTGGTGGAGAAGGGTGGATTGTTAGTGTAGATGATTTAGAAGATATA
ATTGGTGGGCATGTATGGTTGGGTTTTATTTGTGTATTTGGCGGAATTTGGCATATTTTAACCAAACCCTTCGCATGGGCTCGCCGTGCATTTGTATGGT
CTGGAGAAGCTTACTTGTCTTATAGTTTAGCTGCTTTATCTGTCTTTGGTTTTATCGCTTGTTGTTTTGTATGGTTCAATAATACAGCTTATCCGAGTGA
GTTTTATGGACCCACCGGGCCAGAAGCTTCTCAAGCTCAAGCATTTACTTTTCTAGTTAGAGACCAGCGTCTTGGAGCTAATGTGGGATCCGCTCAAGGA
CCCACAGGTTTAGGTAAATATCTAATGCGTTCCCCAACTGGGGAGGTTATCTTTGGAGGGGAAACTATGCGTTTTTGGGACCTTCGTGCTCCATGGTTAG
AACCTCTAAGGGGCCCCAACGGTTTGGACTTGAGTAGGTTGAAAAAAGACATACAACCTTGGCAAGAACGACGCTCAGCAGAATATATGACCCACGCTCC
TTTAGGCTCTTTAAATTCCGTGGGTGGCGTAGCTACCGAGATCAATGCAGTTAATTATGTCTCTCCTAGAAGTTGGTTATCAACTTCTCATTTTGTTCTA
GGATTCTTCTTTTTTGTGGGCCATTTATGGCATGCAGGAAGAGCCCGAGCTGCTGCAGCAGGTTTTGAAAAGGGAATCGATCGTGATTTGGAACCTGTTC
TTTACATGAACCCTCTTAACTAAGATTTTCTTATTTATACCTGTTCTACTTTTTTTCTGTTCTGGCTCGGTTATTCCATCTAGCCGAGCCATTCATTCCT
TTTTATGAAAGAAAGATAAGGGACAGAAAAAAAAAA
page-top