Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23405  (registered. 2007)
Contig Information
Length 797 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_SHC Shoot grown with cold treatment 7
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_003884 [Oryza sativa (japonica cultivar-group)]
Score 745
Evalue 4.05465e-77
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23405
TTTTTTTTTTAGGATAAGGGAACCATATTCATCTCAAACTGGGGAACAAAACTCATAACAGGTAGCACTTTCCCTTAACAGGAGCAAAATGTGACAAGGC
AAAGTTTTCACCAACACGATCATAAGTTATCAACTTAAAAGTGCTGTAAACACAAAGGAACCATCCTCCTTCAACATCTAAAGGCCCGACATACTGTCTA
TTCCATGCAACGGCAATCTAAGACCTGGGCTTCTCCTTCTTTTCCTTGAAGAGGGCAAGCAGAGACACACCAGACACCTTGACGACCTTGAACCGAACAC
CGGGAATATCTCCCACAGCATGTCCCTTACGACCGAATCCAGCAATCAGCACCTCGTCATTCTCCTCGATGAAGTTCAGGCAACCATCATTGGGAACGAA
GGCAGCGATCTTCTTTCCGTTCTTCACAAGCTGCACACGAGCACACTTACGGATGGCAGAGTTAGGCTGCTTGGCCTCAATACCAATCTTCTCCAAAACA
ATGCCCTTGGCATGAGATGACCCGGCGAAGGGTTTCTTCCACTCGTTACCCAAGTGGCTCTTCTTGTATGCCTTGTCAGCCCACCTCTGGTTCCTGCGGT
GGGTCTTGAGCTTGCGCCCAGCTCCCATACCACGTGTCTTACCCATGTTGGCGAAAGGGGTGGGAAGAACTCCGACGAGGAGGCGGCGGCGGCGGCTGGG
CGAGGGAGCGCGAGCTGGCCTCGTGCCGAATTCGGCCACGAGGTATTACTCTGCCTCAANTCATAATCTGCTTCGAGNTCACATTTGCATATCTGAC
page-top