Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23380  (registered. 2007)
Contig Information
Length 823 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 8
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_VSCB Liquid cultured tissue 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0569200 [Oryza sativa (japonica cultivar-group)] >gi|77556849|gb|ABA99645.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113649578|dbj|BAF30090.1| Os12g0569200 [Oryza sativa (japonica cultivar-group)]
Score 465
Evalue 1.24748e-44
Total Hit Count 15
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23380
CCGGCATCAGTCACTCCTCTTCACTCCTAACCAGCGAGTAACACTCCAAGCAGCCAATGGCGTTCTCCAAGCCCCTGGCGGCTCTCCTCCTCGCCGTGGC
GCTGGCAGCGACTGCCATGTCCGCCGCCGGTCAGGATCCCCAAAACTGCAAGCCGAGCCGCAAGGTGACGGTGCAGAACCTGTGCGGCAAGGACCTCTAC
CTCGGTATCGAGCCGCTGGCCAACAGCAAGCTCCTCTACAGCCCTGGCTTCCTGCTCCGCCACGGCACCCACGTGTCGTACGACGTGTGCTCGTGGACGG
GGCGCGTGAAGGTGCAGGACGCCGTGGTGACGGAGTTCCACATCGGGTACGACGGCGGGGCGTGGTACCAGGTGAGCACCGCCCAGTCGCACATGCCCAT
CCGTGTCTCCATCACCCCCCACGGCCACCCCCTGAAAGACCACTGCCCCACCGCCGGCTGCAACAGCGGCGGCCACTGCTTCGAGCACTCCGTCCCCGGC
GGCAAGTGCCACGGCGTCGACGAGATCAAGATCGTCTTCTACAACCCCTAGATCCAGCTGATGGGTGTGTTTAATAAGTTTGCAGCTCGGTGATCCTAGT
CGTATTGCAGCTGCTAGTTAGTTAATCATCTGCTCCAACGAGCTATTGTCGTGTCGTGTCGTCGATTTGCTGTTCAATTAGTAGGTGCGTGGTGAATGTG
TGACTAGAGATGTTTCATTGTCGTGCAATGAACTGCATGTCGTCAGCTCTGTGTCCGTCCTTGGTGTGTTGTGTGTGTTCTANTTTGAATCTACTTTAAA
ATTTGGCTGGGTCAAAAAAAAAA
page-top