Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23363  (registered. 2007)
Contig Information
Length 700 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 3
Wh_SHC Shoot grown with cold treatment 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.1 >gi|21801|emb|CAA42530.1| histone H2B [Triticum aestivum]
Score 456
Evalue 1.0144e-43
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23363
TTTTTTTTTTGAACCAACAACGCAACATTGTTTCCGACGAGCCAAAAAAGCATTGGCAATGATTCGGCAATTTTCATCCAACAGTAGGACTAATATTACT
TGCAGATAACCAGAGTCCACAGACAAGCACTAAACCAACAGGAAGGAACTGCATTTGCTACTAGATACAGGCGACGCAATCTAAGAGGAGGTGAACTTGG
TGACGGCCTTGGTGCCCTCAGAGACGGCGTGCTTGGCGAGCTCCCCGGGGAGGACGAGGCGGACGGAGGTCTGGATCTCCCGGGAGGTGATGGTGGGCTT
CTTGTTGTAGCGGGCGAGCTTGGAGGCCTCCCCGGCGAGCTTCTCGAAGATGTCGTTGATGAAGGAGTTCATGATGGACATGGCCTTGGAGGAGATGCCG
ATGTCGGGGTGCACCTGCTTCAGCACCTTGAAGATGTAGATTTTGTAGGTCTCGACGCTCTTCTTGCTCTTCTTCTTGCCCTTCTTCTCGCCGCCCTCCT
TGGAGGCGGTCTTGCCGGCTGGCAGCCGCTTCTCGGCCTTGGGCTTCTTCGCCGCCGGGGCCTTCTCGGCCTTCTCCGCCGCGGGCTCCTCCTCCGCGGG
CTTCTTCGCCGCCGGCTTCTTCTCCGCCTTGGGGGCCATCGCTGCTTCGGGAGGGAGAGAAGGGTGGGTGGGTTGCTTCGCCGCCGGAAGGTGTTGGGAT
page-top