Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23357  (registered. 2007)
Contig Information
Length 1389 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_PCDAM Anther at meiosis 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0881300 [Oryza sativa (japonica cultivar-group)] >gi|20161429|dbj|BAB90353.1| putative MtN3 [Oryza sativa Japonica Group] >gi|21952819|dbj|BAC06235.1| putative MtN3 [Oryza sativa Japonica Group] >gi|113534529|dbj|BAF06912.1| Os01g0881300 [Oryza sativa (japonica cultivar-group)] >gi|215695492|dbj|BAG90683.1| unnamed protein product [Oryza sativa Japonica Group]
Score 991
Evalue 2.8406e-105
Total Hit Count 335
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23357
TTTTTTTTTTCAGGCAGAAACCAAATTCGATCTTTGGAGGAGTACAACACACAGAAACAGAGCAGAGGTAGTAATTCACACTTGCAGTTACAGTTTGAGA
TTTTCGGAGTACTGTTTCATAGCTCTCCCGTAGGCTGGCCTTTGGGGAGAGGGTTCCGCACCAGCTTTCTTTCTGGCAAATGTACGTGTACGTACCAAGT
CAAGAAACAAATCAACAAGGCAGACACCCACGATCTGCGTAGCATAATAGCTCTACTAACTAATTAAGCAGCGCACTTATGCTGCTGTCACTCCATGCAA
GCTCTCTCTGCAACGGCGGCGGCTACACCTGCGCGGCGACCTTGTCGACAACGGCCGGCTCGTCGACGACGGCGGTGTCGTCGTCGACCTTGATCTTTGC
CTCGCCCATCTCCACTGCAGCTGCCGCCTTCTTGGCGTCCTCCACCTCGTCGGCGTCGTCGGCGTCCTCCCCCTTGCCGGCGCCGGCGGCGGGGCCCTTG
TTCTTCCGGTAGATGGCGTAGAGGATGAGCTGCATCAGGCCCAGGAAGCTCCCGCACCCGTTGGGGATGTAGATGAAGGGGTCGAGGCCGAGCAGGCCGT
AGATGAACCAGGAGGTGCCGCAGAGGAACACGGACAGGGACAGCAGGAACGGCATGTACTCCACGCTCTTGGTCTTGATCACCAACCTCATGATGGAGAG
CGGCGAGGCGTACATGCAGATGGAGAAGACGGTGGCGGCGAGGCCGCAGAAGACGGTGCGGGCCTTGCCGTGCAGCGCCAGCAGCGACACCAGCACCACC
GTGGCGAAGATGGCGGTGACCACGCTGAGGAGGCCCAGCATCCGGACCTTGGCCCTGCGCTCCGCGAAGATGAGGAAGATGACCACGTAGATTGCCTCGA
TCACCGACCCCGCGCCGTTGATCGTCGTCACCAGGATGTTGTTCGGGGACACGAACGGCAGCCCGTACCATGCGGATAGGAGGCAGTTGAGCAGCGTCAT
GTTGTATGGCACGCCGGAGAAGTCCTCCGTCGACTTCCTCTTGATGATCCTCCAGAAGGTGATGACCGGCGACAGGAAGAGGAACAGAGCGATAACATTG
CCTGAGACCCCGAAGAAGAACCTCGCGATATGCTCCATCTCGGCGCGTCTGCCCCAAGAACACGGTGGGGGTAGAGGGGGAGGTGAGGTCTATCTATCCT
TCTCGGCCGAGCGAGAGGAGAGGGGAGGAGTGTAGAGGACAGAGGACAGAGGAGCACTCGGGCACTCAGCTGCACCGAGTAGCTCTCAGCTCCCAACGGC
TCGGTAATCAGCACCGCGCTAGGCAACACGGGAGCTGCGTTACGAATGCGGCGTGTCTTTCTCGGCGTCTGCGGTGATGTACTGATGCG
page-top