Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23356  (registered. 2007)
Contig Information
Length 1161 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 8
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194707896|gb|ACF88032.1| unknown [Zea mays]
Score 661
Evalue 4.07666e-67
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23356
TCTCTCTTATCTCAGCAACACAGACAGGTCCCTTTCCCCTTCTTCGTACGCCTCCAGGCCATCTAGCTCGCTCGGATTACGGCCGTCGGCGGCGGTGCTT
CCAGAGGTGAGCGGCATGGCAGGGGCGGGGGCGGAGGAGGCGGTGGTGGGCGAGAGCTTCGAGTTCGCCTTTGACAAGGAGGCCTTCTCCGACAAGAAGC
TGCGGGTCGAGGTCGTCGGCAGCGACGACGCCGCCAGCCGCAAGCGCCGCCGCGAGGACGACAAAAGTGATGAAGGAGAATGTGTTGATTCTTCTTCTAT
AGTGATGGCTGCACCAACTTTACGAGTCACTACCATGCATATCAATTCGGCCATTCTTGCTGCAAAAAGCCCTTTCTTTTTCAAGCTTTTCTCAAACGGC
ATGAAAGAGTCTGACAAGGGACAGGCAACACTTCGAATAGCTGATTCAGAGGAAAATGCCTTCATGGAGCTTTTGTACTTTATGTATAGTGGAAAGTTGA
CACCAACAACTGAGCCCACTCATCTGGTTGATATCTTGATGGCCGCTGACAAATTTGAGGTCATTTCTTGCATTAAGCTTTGCGGTCAGTTGCTCACAAG
CTTGCCTATGACCCCAGAATCTGCAGTGCTGTGCCTAGATCTACCATATTCCATTTCAATGGCACCTGCCCTGGCAGTGGCAGCCAAGAAATTCTTTGCT
GAAAGATACAAGGATTTCCTGTCAACAAAGTTACAAGACGAACTGATGAGGATCCCTCTCGCAGGGATCCTAGCCATCTTATCAAGGAATGACCTCGGAG
TTTTACCTGAAGAAGCCGTCTATGACTTTGTGCTCAGGTGGGCTGATTCGCAGTACCCAAATCCAGAAGAAAAACGCAAGATCTTGAGTTCACAGTTACT
TCCACTAGTACCACTAGTGCGAAGTAGAGTCAGAACCATTGTACTTGATTAGCCGTCTTGTATAATCAACTTCAGTCTAGAGTTGATTATCTTGTATGTG
GTAGACCCTGTAGGGCTGTAGGCTGGTGAGATACATAGTCTGGTTTGTGTGACTAGTGTACCGTGTTGTTGCCGTGTTTGTCCTGCTATGCAGCAAAGTC
GCTGAACTGTCTTTGTCGGAAGTTGGCTAATATATTGCTGATTACCTCTGTAAAAAAAAAA
page-top