Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23343  (registered. 2007)
Contig Information
Length 650 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0332800 [Oryza sativa (japonica cultivar-group)] >gi|50725425|dbj|BAD32898.1| putative bundle sheath defective protein [Oryza sativa Japonica Group] >gi|50725497|dbj|BAD32967.1| putative bundle sheath defective protein [Oryza sativa Japonica Group] >gi|113595588|dbj|BAF19462.1| Os06g0332800 [Oryza sativa (japonica cultivar-group)] >gi|125555175|gb|EAZ00781.1| hypothetical protein OsI_22808 [Oryza sativa Indica Group] >gi|125597084|gb|EAZ36864.1| hypothetical protein OsJ_020347 [Oryza sativa (japonica cultivar-group)] >gi|215765751|dbj|BAG87448.1| unnamed protein product [Oryza sativa Japonica Group]
Score 413
Evalue 8.45896e-39
Total Hit Count 234
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23343
GCTCGTCTCCTCTATCTTGTTGGCCGCCCATCTCGACTCTCCAAACTCTCAGCTCCCTCCCTCGCACACGCCGTTCTCGAATGGCGGCCACCTCCGGCCT
CACGGCCACCGTTACCTCCCCTCCGGCCGCCCTTAGAACCTCGCCTCCTCCCGTTCTCTTCCTCCGCCCCATCTCTCGCTGCTCCAGGCTCCATTCCCTC
AAGGCCAAGGCAGCAGCAAAGGACCAGGACGAAAAGAAGCCCGAAGCTACCAAAAAGAAGGCATACAGTCTTGTTTGCACTGCCTGCGAAGGGAACGGCG
CAATCGCATGCACCCAATGCAAGGGAGGTGGGGAGAATTTGGAAGACCATTTCGGTGGCCGATTCAAAGCTGGAGGATTATGCTGGCTTTGCAGAGGAAA
GCGTGAAATTCTATGTGGGAGCTGCAATGGCGCTGGCTTCTTGGGTGGATTTATGAGCACTGCCGATGACACTTCCGAATGAAATGCTTATGTTGTTATT
TTTTTTTGCTTATGTTGTGTTTGACAAATTTTGGGAGATCTGTAACATTTTTACTTATATCCCCTCCAAGGAATGTGTCCCTTAGAACATTTATTGCATT
TAATAATTGCATATTTTTTTATTTGTGACAAAGTATGTCACTAAAAAAAA
page-top