Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23339  (registered. 2007)
Contig Information
Length 1823 bp
Clones 17 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 1
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 6
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CIPK9 (CBL-INTERACTING PROTEIN KINASE 9); kinase [Arabidopsis thaliana]
Score 1025
Evalue 2.14196e-177
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23339
GACCGGTGACCCAACGACCCAGCGTCGACCTACCTCCTACCCTCATCCATCCATTGATCCATTGATTTGATTGATTAATTCATCCGCCACCACCGTACCG
CCACCGAGGAAGGAGGGATGGCGGCGGCGGGCGGGGGGCCGAGGCGGACGACGCGGGTGGGGCCGTACGAGCTCGGCAAGACCGTCGGCGAGGGCAGCTT
CGCCAAGGTCAAGATCGCCAAGGACACCCGCAACGCCGCCACCTGCGCCATCAAGGTGCTCGACCGCAACCACGTCCTACGACACAAGATGGTCGAGCAG
ATTAAAAGGGAGATCGCCACAATGAAGCTAATAAGACATCCCAATGTGGTCCAGCTGCATGAGGTGATGGCTAGCAAATCAAAGATATACATGGTTCTTG
AGTTTGTCGAAGGAGGCGAGCTTTTTGATAAGATTGTCAATTCTGGGAAGCTGGGAGAAGATGAAGCAAGACGATACTTCCACCAACTTATAAATGCGGT
GGATTATTGTCATAGTCGTGGAGTGTACCATAGAGATCTCAAGCCAGAAAATCTGCTCCTTGATTCATATGGAGCTCTCAAAGTCTCAGACTTCGGCCTC
AGCGCATTTTCTCCGCAAACAAAGGAGGATGGACTTCTGCATACTGCTTGTGGAACTCCAAATTATGTTGCGCCTGAGGTGCTTGCTGATAAAGGTTATG
ATGGTATGGCTGCTGATGTGTGGTCCTGTGGCATAATCTTATTTGTCCTTATGGCTGGATATTTGCCCTTCGATGATCCCAACTTAATGACTCTGTATAA
ATTGATCGCCAGAGCTAATGTTTCTTGTCCACCATGGTTTTCTACCGGTGCAAGAAATCTTATTAAGCGCATTCTTGATCCCAATCCTCACACGAGGGAT
AACAATCGCCCAAATTTTGGAAGATGAATGGTTCAAAAAGGACTATAAACCACCACAGTCTGAGCACAATGAAGATGTGAGCCTTGAAGATGTCGATGCT
GCATTCGATAGTTCAGAGGAACACCTTGTGGCGGAGAGAAGAGAGAAACCAGAATCCATGAATGCATTTGCTCTTATTTCAAGGTCGGAGGGGTTCAATC
TCGGAAATTTGTTTGAGAAAGAGATGATGGGGATGGTAAAGCGGGAAACATCCTTTGCGTCGCAACGTACACCACAAGAGATCATGTCTAAAATAGAGGA
AGCCTGTGGCCCTCTTGGTTTCAATGTGCGGAAGCAAAATTATAAGATGAAACTGAAAGGTGACAAGACAGGAAGAAAAGGCCATTTATCTGTAGCAACA
GAGGTTTTTGAGGTTGCTCCAACACTCCATATGGTTGAACTTCGTAAAACTGGAGGGGACACCTTGGAGTTTCACAGTTTCTACAAGAATTTCTCATCAG
AACTAAAAGACATTGTGTGGAAAACTGAATCCAACACAATTGCGAAATAGTCGCGATGATTGATACTTTGCGGAATGGAACTATCTTGCGGTGCTGTATC
GATGGACCACCCCTTGAGGTGATACCGCTGGGCGCTGGGTACTGTATATTTCTCCGGCACCGCATCGATGGTCCAGTTCCGCCGTCTCTTGTTGAAGACA
GCGCCTTTTTTTTACCGAGCGCGATTGTACAATTACATGTACAACGAGGCCCTCCCGGACATGCTCCTTGTAATATTGCAACGGGGTGCCTAACAGGCAT
CCTGAATGTGCTTTAGTTTGCACCAGGGTTGTGTGCCTTCCTTTATTTTTGTATTGGAAGTATTTAAGAATCGTAAGATGAATAAAGGTAGTTCAGACTT
GAGATTGTAAGGCAAAAAAAAAA
page-top