Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig23291  (registered. 2007)
Contig Information
Length 1463 bp
Clones 16 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 3
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine synthetase [Triticum aestivum]
Score 2003
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig23291
CACGTCATCCCCTAGCCTCCCGCCGCCGTCGCCGCCCCCGCCGCCACAAGCGAACAAGGCCAAAGAAGATGGCTGAAGTTGAAACCTTCCTCTTCACGTC
TGAGTCTGTCAATGAGGGGCACCCTGACAAGCTCTGCGACCAGATATCTGATGCTGTGCTAGATGCATGCCTGGCTGAAGACCCTGACAGCAAGGTTGCT
TGTGAGACATGCACCAAGACCAACATGGTCATGGTTTTCGGTGAGATCACTACCAAGGCCAATGTTGACTATGAGAAGATTGTCAGGGATACTTGCCGTG
GCATCGGTTTTGTGTCCAATGATGTAGGGCTTGATGCTGACCACTGCAAGGTACTTGTCAACATTGAGCAGCAGTCCCCTGACATCGCGCAGGGTGTCCA
TGGCCACTTTACCAAGCGGCCTGAGGAGATTGGCGCTGGTGACCAGGGCCATATGTTTGGATATGCAACTGATGAGACTCCGGAGTTCATGCCCCTCAGC
CATGTTCTTGCTACCAAGCTTGGTGCTCGTCTCACCGAGGTCCGCAAGAACGCCACCTGCCCGTGGTTGAGGCCTGATGGCAAGACCCAGGTGACTGTGG
AGTATCACAATGACAATGGTGCTATGGTCCCTATACGTGTCCACACTGTGCTCATTTCCACCCAGCACGATGAGACAGTGACCAATGATGAGATTGCTGC
TGATCTGAAGGAGCATGTGATTAAGCCTGTCATCCCAGAGCAGTACCTTGATGAGAATACCATCTTCCATCTCAACCCATCTGGCCGCTTTGTCATTGGT
GGACCTCACGGTGATGCTGGTCTCACTGGCAGGAAGATCATCATTGACACCTATGGTGGCTGGGGAGCTCATGGTGGAGGCGCTTTCTCTGGCAAGGACC
CGACCAAGGTTGACCGCAGTGGTGCATATGTTGCCAGGCAGGCGGCGAAGAGCATTGTTGCAAGCGGCATTGCCCGCCGCTGCATCGTCCAGGTGTCTTA
TGCTATTGGCGTGCCTGAACCACTCTCGGTGTTTGTCGACACATACGGCACGGGCAAGATCCCTGACAAGGAGATCCTCGAGATTGTCAAGGAGAACTTT
GACTTCAGGCCAGGCATGATCATCATCAACCTCGACCTCAAGAGGGGTGGGAAGGGGCGCTACCTCAAGACGGCGGCATACGGTCACTTCGGCAGGGAGG
GCGCAGACTTCACCTGGGAGGTGGTGAAGCCCCTCAAGTGGGAGAAGCCTTCTGCGTGAGCAAACACTTAGCGAACTCTNTGAATAAATTTAGTTTTACC
TATCACAGCAAGTAATATCTCTATTCACTGCTCCAGTGCTTGCTGCAATGGTGCAAGTTTTTTTTTTTGAGTGTCTGTGTTTAGAGGTGCTTGTATTGTG
GGTGTGCTACTTGTGTTCTTATCTGCTCATGTCATGGTAAATGGTGGCGACCAAGATTGAAAC
page-top